Morpholino

MO2-lin9

ID

ZDB-MRPHLNO-090817-2

Name

MO2-lin9

Previous Names

None

Target

Sequence

5' - GTTAGTTTTATTACTCACTCTCGTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Targets the exon1-intron1 boundary.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-lin9

No data available

Phenotype

Phenotype resulting from MO2-lin9

Phenotype	Fish	Figures
brain apoptotic, abnormal	AB/TU + MO2-lin9	Fig. 4 from Kleinschmidt et al., 2009
brain nucleus apoptotic, abnormal	AB/TU + MO2-lin9	Fig. 5 from Kleinschmidt et al., 2009
cell death increased occurrence, abnormal	AB/TU + MO2-lin9	Fig. 3, Fig. 6 from Kleinschmidt et al., 2009
eye decreased size, abnormal	AB/TU + MO2-lin9	Fig. 2 from Kleinschmidt et al., 2009
head decreased size, abnormal	AB/TU + MO2-lin9	Fig. 2 from Kleinschmidt et al., 2009
mitotic cell cycle increased occurrence, abnormal	AB/TU + MO2-lin9	Fig. 5 from Kleinschmidt et al., 2009
olfactory system apoptotic, abnormal	AB/TU + MO2-lin9	Fig. 4 from Kleinschmidt et al., 2009
pericardium edematous, abnormal	AB/TU + MO2-lin9	Fig. 2 from Kleinschmidt et al., 2009
regulation of cell cycle disrupted, abnormal	AB/TU + MO2-lin9	Fig. 3, Fig. 6 from Kleinschmidt et al., 2009
trunk curved dorsal, abnormal	AB/TU + MO2-lin9	Fig. 2 from Kleinschmidt et al., 2009

Phenotype of all Fish created by or utilizing MO2-lin9

Phenotype	Fish	Conditions	Figures
olfactory system apoptotic, abnormal	AB/TU + MO2-lin9	standard conditions	Fig. 4 from Kleinschmidt et al., 2009
regulation of cell cycle disrupted, abnormal	AB/TU + MO2-lin9	standard conditions	Fig. 3, Fig. 6 from Kleinschmidt et al., 2009
cell death increased occurrence, abnormal	AB/TU + MO2-lin9	standard conditions	Fig. 3, Fig. 6 from Kleinschmidt et al., 2009
brain apoptotic, abnormal	AB/TU + MO2-lin9	standard conditions	Fig. 4 from Kleinschmidt et al., 2009
mitotic cell cycle increased occurrence, abnormal	AB/TU + MO2-lin9	standard conditions	Fig. 5 from Kleinschmidt et al., 2009
eye decreased size, abnormal	AB/TU + MO2-lin9	standard conditions	Fig. 2 from Kleinschmidt et al., 2009
pericardium edematous, abnormal	AB/TU + MO2-lin9	standard conditions	Fig. 2 from Kleinschmidt et al., 2009
brain nucleus apoptotic, abnormal	AB/TU + MO2-lin9	standard conditions	Fig. 5 from Kleinschmidt et al., 2009
head decreased size, abnormal	AB/TU + MO2-lin9	standard conditions	Fig. 2 from Kleinschmidt et al., 2009
trunk curved dorsal, abnormal	AB/TU + MO2-lin9	standard conditions	Fig. 2 from Kleinschmidt et al., 2009

Citations