Morpholino

MO4-tbx16

ID

ZDB-MRPHLNO-090730-2

Name

MO4-tbx16

Previous Names

None

Target

Sequence

5' - AAGACAAGTACTCACCTCTGATAGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking morpholino targets the exon 1 donor splice site.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO4-tbx16

Expressed Gene	Anatomy	Figures
aldh1a2	pronephric duct pronephros segmental plate somite	Fig. 6 from Wingert et al., 2011
clcnk	posterior pronephric duct pronephric distal early tubule pronephric distal late tubule	Fig. 6 from Wingert et al., 2011
gata3	corpuscles of Stannius posterior pronephric duct	Fig. 6 from Wingert et al., 2011
hnf4a	pronephric proximal convoluted tubule pronephric proximal straight tubule	Fig. 6 from Wingert et al., 2011
irx3b	pronephric distal early tubule pronephric proximal straight tubule	Fig. 6 from Wingert et al., 2011
mecom	posterior pronephric duct pronephric distal late tubule	Fig. 6 from Wingert et al., 2011
myb	(not) ventral wall of dorsal aorta hematopoietic stem cell	Fig. 4 from Burns et al., 2009
runx1	(not) ventral wall of dorsal aorta hematopoietic stem cell	Fig. 4 from Burns et al., 2009
slc4a4a	pronephric proximal convoluted tubule pronephric proximal straight tubule pronephros	Fig. 6 from Wingert et al., 2011
slc12a1	pronephric distal early tubule	Fig. 6 from Wingert et al., 2011
slc12a3	pronephric distal late tubule	Fig. 6 from Wingert et al., 2011
slc20a1a	pronephric proximal convoluted tubule	Fig. 6 from Wingert et al., 2011
trpm7	pronephric proximal straight tubule	Fig. 6 from Wingert et al., 2011
wt1b	podocyte	Fig. 6 from Wingert et al., 2011

Phenotype

Phenotype resulting from MO4-tbx16

Phenotype	Fish	Figures
pronephric duct distal region increased length, abnormal	TU + MO4-tbx16	Fig. 6 from Wingert et al., 2011
pronephric duct proximal region decreased length, abnormal	TU + MO4-tbx16	Fig. 6 from Wingert et al., 2011

Phenotype of all Fish created by or utilizing MO4-tbx16

Phenotype	Fish	Conditions	Figures
pronephric duct distal region increased length, abnormal	TU + MO4-tbx16	standard conditions	Fig. 6 from Wingert et al., 2011
pronephric duct proximal region decreased length, abnormal	TU + MO4-tbx16	standard conditions	Fig. 6 from Wingert et al., 2011
ventral wall of dorsal aorta hematopoietic stem cell absent, abnormal	kca3Tg; kca4Tg + MO4-tbx16	standard conditions	Fig. 4 from Burns et al., 2009
hematopoietic stem cell differentiation disrupted, abnormal	kca3Tg; kca4Tg + MO4-tbx16	standard conditions	Fig. 4 from Burns et al., 2009

Citations