Morpholino

MO1-upf1

ID

ZDB-MRPHLNO-090714-1

Name

MO1-upf1

Previous Names

Upf1 StartSite (1)

Target

upf1 (1)

Sequence

5' - CGCCTCCACACTCATCTTTATATTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-upf1

No data available

Phenotype

Phenotype resulting from MO1-upf1

Phenotype	Fish	Figures
brain necrotic, abnormal	WT + MO1-upf1	Fig. s1 from Anastasaki et al., 2011
central nervous system necrotic, abnormal	TU + MO1-upf1	Fig. 2, Fig. S3 from Wittkopp et al., 2009
embryo development delayed, abnormal	WT + MO1-upf1	Fig. s1 from Anastasaki et al., 2011
extension disorganized, abnormal	TU + MO1-upf1 + MO4-tp53	Fig. 2, Fig. S3 from Wittkopp et al., 2009
eye development process quality, abnormal	TU + MO1-upf1 + MO4-tp53	Fig. 2, Fig. S3 from Wittkopp et al., 2009
mRNA splicing, via spliceosome decreased occurrence, abnormal	TL + MO1-upf1	Fig. 6 from Lei et al., 2017
nuclear-transcribed mRNA catabolic process, nonsense-mediated decay increased process quality, abnormal	TL + MO1-upf1	Fig. 6 from Lei et al., 2017
somite malformed, abnormal	WT + MO1-upf1	Fig. s1 from Anastasaki et al., 2011
somitogenesis process quality, abnormal	TU + MO1-upf1	Fig. 2, Fig. S3 from Wittkopp et al., 2009
whole organism atxn1b expression increased amount, abnormal	TL + MO1-upf1	Fig. 6 from Lei et al., 2017
whole organism appb expression increased amount, abnormal	AB + MO1-upf1	Figure 7. from Rahmati et al., 2024
whole organism mmp30 expression increased amount, abnormal	TL + MO1-upf1	Fig. 6 from Lei et al., 2017
whole organism appa expression increased amount, abnormal	AB + MO1-upf1	Figure 7. from Rahmati et al., 2024
whole organism aplp1 expression increased amount, abnormal	AB + MO1-upf1	Figure 7. from Rahmati et al., 2024
whole organism aplp2 expression increased amount, abnormal	AB + MO1-upf1	Figure 7. from Rahmati et al., 2024
whole organism anterior-posterior axis decreased length, abnormal	WT + MO1-upf1	Fig. s1 from Anastasaki et al., 2011

Phenotype of all Fish created by or utilizing MO1-upf1

Phenotype	Fish	Conditions	Figures
whole organism appa expression increased amount, abnormal	AB + MO1-upf1	standard conditions	Figure 7. from Rahmati et al., 2024
whole organism appb expression increased amount, abnormal	AB + MO1-upf1	standard conditions	Figure 7. from Rahmati et al., 2024
whole organism aplp1 expression increased amount, abnormal	AB + MO1-upf1	standard conditions	Figure 7. from Rahmati et al., 2024
whole organism aplp2 expression increased amount, abnormal	AB + MO1-upf1	standard conditions	Figure 7. from Rahmati et al., 2024
mRNA splicing, via spliceosome decreased occurrence, abnormal	TL + MO1-upf1	standard conditions	Fig. 6 from Lei et al., 2017
nuclear-transcribed mRNA catabolic process, nonsense-mediated decay increased process quality, abnormal	TL + MO1-upf1	standard conditions	Fig. 6 from Lei et al., 2017
whole organism atxn1b expression increased amount, abnormal	TL + MO1-upf1	standard conditions	Fig. 6 from Lei et al., 2017
whole organism mmp30 expression increased amount, abnormal	TL + MO1-upf1	standard conditions	Fig. 6 from Lei et al., 2017
somitogenesis process quality, abnormal	TU + MO1-upf1	standard conditions	Fig. 2 from Wittkopp et al., 2009
eye development process quality, abnormal	TU + MO1-upf1	standard conditions	Fig. 2 from Wittkopp et al., 2009
central nervous system necrotic, abnormal	TU + MO1-upf1	standard conditions	Fig. 2 from Wittkopp et al., 2009
extension disorganized, abnormal	TU + MO1-upf1	standard conditions	Fig. 2 from Wittkopp et al., 2009
eye development process quality, abnormal	TU + MO1-upf1 + MO4-tp53	standard conditions	Fig. S3 from Wittkopp et al., 2009
central nervous system necrotic, abnormal	TU + MO1-upf1 + MO4-tp53	standard conditions	Fig. S3 from Wittkopp et al., 2009
extension disorganized, abnormal	TU + MO1-upf1 + MO4-tp53	standard conditions	Fig. S3 from Wittkopp et al., 2009
somitogenesis process quality, abnormal	TU + MO1-upf1 + MO4-tp53	standard conditions	Fig. S3 from Wittkopp et al., 2009
whole organism anterior-posterior axis decreased length, abnormal	WT + MO1-upf1	standard conditions	Fig. s1 from Anastasaki et al., 2011
somite malformed, abnormal	WT + MO1-upf1	standard conditions	Fig. s1 from Anastasaki et al., 2011
embryo development delayed, abnormal	WT + MO1-upf1	standard conditions	Fig. s1 from Anastasaki et al., 2011
brain necrotic, abnormal	WT + MO1-upf1	standard conditions	Fig. s1 from Anastasaki et al., 2011
whole organism appa expression increased amount, abnormal	appb^{zf3355/zf3355} + MO1-upf1 (AB)	standard conditions	Figure 7. from Rahmati et al., 2024
whole organism aplp2 expression increased amount, abnormal	appb^{zf3355/zf3355} + MO1-upf1 (AB)	standard conditions	Figure 7. from Rahmati et al., 2024
whole organism appb expression decreased amount, abnormal	appb^{zf3355/zf3355} + MO1-upf1 (AB)	standard conditions	Figure 7. from Rahmati et al., 2024

Citations