Morpholino
MO1-bmpr1bb
- ID
- ZDB-MRPHLNO-090610-1
- Name
- MO1-bmpr1bb
- Previous Names
-
- alk6b MO1 (1)
- Target
- Sequence
-
5' - ACTGCTCCACAGCTACTCCACACTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-bmpr1bb
No data available
Phenotype
Phenotype resulting from MO1-bmpr1bb
No data available
Phenotype of all Fish created by or utilizing MO1-bmpr1bb
1 - 5 of 7 Show all
Citations
- Allen, R.S., Jones, W.D., Hale, M., Warder, B.N., Shore, E.M., Mullins, M.C. (2023) Reduced GS domain serine/threonine requirements of Fibrodysplasia Ossificans Progressiva mutant type I BMP receptor ACVR1 in the zebrafish. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research. 38(9):1364-1385
- Tajer, B., Dutko, J.A., Little, S.C., Mullins, M.C. (2021) BMP heterodimers signal via distinct type I receptor class functions. Proceedings of the National Academy of Sciences of the United States of America. 118(15):
- Allen, R.S., Tajer, B., Shore, E.M., Mullins, M.C. (2020) Fibrodysplasia ossificans progressiva mutant ACVR1 signals by multiple modalities in the developing zebrafish. eLIFE. 9:
- Little, S.C., and Mullins, M.C. (2009) Bone morphogenetic protein heterodimers assemble heteromeric type I receptor complexes to pattern the dorsoventral axis. Nature cell biology. 11(5):637-643
1 - 4 of 4
Show