header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-090528-1
Morpholino Name: MO1-pld1a
Target: pld1a (1)
Previous Name: MO1-pld1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CCAGGTTCTCCACCGAATCACTCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Targets the ATG start codon and inhibits translation.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-pld1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-pld1a
Expressed Gene Anatomy Figures
kdrl Fig. 6 with image from Zeng et al., 2009
tie1 Fig. 6 with image from Zeng et al., 2009
PHENOTYPE
Phenotype resulting from MO1-pld1a
Phenotype of all Fish created by or utilizing MO1-pld1a
OTHER MO1-pld1a MORPHOLINO PAGESNo links to external sites
CITATIONS (1)