Morpholino

MO1-birc5b

ID
ZDB-MRPHLNO-090513-9
Name
MO1-birc5b
Previous Names
None
Target
Sequence
5' - GAAGTCTTTTTTCATAACTATACAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-birc5b
Expressed Gene Anatomy Figures
bmp4 Fig. 5 with image from Delvaeye et al., 2009
ccnd1 Fig. 9 from Ko et al., 2011
cdkn1bb Fig. 9 from Ko et al., 2011
cdkn1ca Fig. 9 from Ko et al., 2011
crestin Fig. 3 with image from Delvaeye et al., 2009
elavl3 Fig. 6 from Ko et al., 2011
flt4 Fig. 3 with image from Delvaeye et al., 2009
foxd3 Fig. 5 with image from Delvaeye et al., 2009
gata1a Fig. 4 with image from Delvaeye et al., 2009
hey2 Fig. 3 with image from Delvaeye et al., 2009
isl1a Fig. 2 with image from Delvaeye et al., 2009
myh7 Fig. 5 with image from Delvaeye et al., 2009
myl7 Fig. 5 with image from Delvaeye et al., 2009
nes Fig. 9 from Ko et al., 2011
pcna Fig. 9 from Ko et al., 2011
zic1 Fig. 2 with image from Delvaeye et al., 2009
Phenotype
Phenotype resulting from MO1-birc5b
Phenotype Fish Figures
aortic arch hypoplastic, abnormal la116Tg + MO1-birc5b Fig. 3 with image from Delvaeye et al., 2009
atrioventricular valve decreased diameter, abnormal WT + MO1-birc5b Fig. 5 with image from Delvaeye et al., 2009
axial vasculature apoptotic, abnormal WT + MO1-birc5b Fig. 6 with image from Delvaeye et al., 2009
axial vasculature decreased diameter, abnormal y1Tg + MO1-birc5b Fig. 3 with image from Delvaeye et al., 2009
brain decreased size, abnormal WT + MO1-birc5b Fig. 2 with image from Delvaeye et al., 2009
cardiac ventricle decreased size, abnormal WT + MO1-birc5b Fig. 5 with image from Delvaeye et al., 2009
caudal vein plexus apoptotic, abnormal WT + MO1-birc5b Fig. 6 with image from Delvaeye et al., 2009
caudal vein plexus morphology, abnormal y1Tg + MO1-birc5b Fig. 3 with image,  Fig. 8 with image from Delvaeye et al., 2009
caudal vein plexus proliferative region decreased functionality, abnormal WT + MO1-birc5b Fig. 7 with image from Delvaeye et al., 2009
cell population proliferation decreased occurrence, abnormal WT + MO1-birc5b Fig. 7 with image from Delvaeye et al., 2009
endocardial ring decreased size, abnormal WT + MO1-birc5b Fig. 5 with image from Delvaeye et al., 2009
erythrocyte differentiation disrupted, abnormal WT + MO1-birc5b Fig. 4 with image from Delvaeye et al., 2009
G1 to G0 transition disrupted, abnormal WT + MO1-birc5b Fig. 9 from Ko et al., 2011
head decreased size, abnormal WT + MO1-birc5b Fig. 6,  Fig. 9 from Ko et al., 2011
Fig. 2 with image from Delvaeye et al., 2009
head motor neuron disorganized, abnormal WT + MO1-birc5b Fig. 2 with image from Delvaeye et al., 2009
hemopoiesis decreased occurrence, abnormal WT + MO1-birc5b Fig. 7 with image from Delvaeye et al., 2009
lateral plate mesoderm angioblastic mesenchymal cell cellular motility, abnormal y1Tg + MO1-birc5b Fig. 3 with image from Delvaeye et al., 2009
neural tube proliferative region decreased functionality, abnormal WT + MO1-birc5b Fig. 7 with image from Delvaeye et al., 2009
neuron apoptotic process increased occurrence, abnormal WT + MO1-birc5b Fig. 6 from Ko et al., 2011
neuron differentiation disrupted, abnormal WT + MO1-birc5b Fig. 6,  Fig. 9 from Ko et al., 2011
nucleate erythrocyte decreased amount, abnormal WT + MO1-birc5b Fig. 4 with image from Delvaeye et al., 2009
posterior neural tube apoptotic, abnormal WT + MO1-birc5b Fig. 6 with image from Delvaeye et al., 2009
sinus venosus decreased functionality, abnormal WT + MO1-birc5b Fig. 2 with image from Delvaeye et al., 2009
sinus venosus increased accumulation blood, abnormal WT + MO1-birc5b Fig. 2 with image from Delvaeye et al., 2009
Phenotype of all Fish created by or utilizing MO1-birc5b
Phenotype Fish Conditions Figures
sinus venosus decreased functionality, abnormal WT + MO1-birc5b standard conditions Fig. 2 with image from Delvaeye et al., 2009
atrioventricular valve decreased diameter, abnormal WT + MO1-birc5b standard conditions Fig. 5 with image from Delvaeye et al., 2009
neuron apoptotic process increased occurrence, abnormal WT + MO1-birc5b standard conditions Fig. 6 from Ko et al., 2011
endocardial ring decreased size, abnormal WT + MO1-birc5b standard conditions Fig. 5 with image from Delvaeye et al., 2009
axial vasculature apoptotic, abnormal WT + MO1-birc5b standard conditions Fig. 6 with image from Delvaeye et al., 2009
posterior neural tube apoptotic, abnormal WT + MO1-birc5b standard conditions Fig. 6 with image from Delvaeye et al., 2009
cell population proliferation decreased occurrence, abnormal WT + MO1-birc5b standard conditions Fig. 7 with image from Delvaeye et al., 2009
caudal vein plexus proliferative region decreased functionality, abnormal WT + MO1-birc5b standard conditions Fig. 7 with image from Delvaeye et al., 2009
hemopoiesis decreased occurrence, abnormal WT + MO1-birc5b standard conditions Fig. 7 with image from Delvaeye et al., 2009
neural tube proliferative region decreased functionality, abnormal WT + MO1-birc5b standard conditions Fig. 7 with image from Delvaeye et al., 2009
sinus venosus increased accumulation blood, abnormal WT + MO1-birc5b standard conditions Fig. 2 with image from Delvaeye et al., 2009
caudal vein plexus apoptotic, abnormal WT + MO1-birc5b standard conditions Fig. 6 with image from Delvaeye et al., 2009
head decreased size, abnormal WT + MO1-birc5b standard conditions Fig. 6,  Fig. 9 from Ko et al., 2011
Fig. 2 with image from Delvaeye et al., 2009
head motor neuron disorganized, abnormal WT + MO1-birc5b standard conditions Fig. 2 with image from Delvaeye et al., 2009
neuron differentiation disrupted, abnormal WT + MO1-birc5b standard conditions Fig. 6,  Fig. 9 from Ko et al., 2011
G1 to G0 transition disrupted, abnormal WT + MO1-birc5b standard conditions Fig. 9 from Ko et al., 2011
brain decreased size, abnormal WT + MO1-birc5b standard conditions Fig. 2 with image from Delvaeye et al., 2009
cardiac ventricle decreased size, abnormal WT + MO1-birc5b standard conditions Fig. 5 with image from Delvaeye et al., 2009
erythrocyte differentiation disrupted, abnormal WT + MO1-birc5b standard conditions Fig. 4 with image from Delvaeye et al., 2009
nucleate erythrocyte decreased amount, abnormal WT + MO1-birc5b standard conditions Fig. 4 with image from Delvaeye et al., 2009
aortic arch hypoplastic, abnormal la116Tg + MO1-birc5b standard conditions Fig. 3 with image from Delvaeye et al., 2009
axial vasculature decreased diameter, abnormal y1Tg + MO1-birc5b standard conditions Fig. 3 with image from Delvaeye et al., 2009
caudal vein plexus morphology, abnormal y1Tg + MO1-birc5b standard conditions Fig. 3 with image,  Fig. 8 with image from Delvaeye et al., 2009
lateral plate mesoderm angioblastic mesenchymal cell cellular motility, abnormal y1Tg + MO1-birc5b standard conditions Fig. 3 with image from Delvaeye et al., 2009
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.