header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-090513-4
Morpholino Name: MO2-foxj1b
Target: foxj1b (1)
Sequence:
5' - CGAAATGAAAACACGCCGAATAACT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Designed to target the 5' UTR region of foxj1b to block normal translation of the protein.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-foxj1b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-foxj1b No data available
PHENOTYPE
Phenotype resulting from MO2-foxj1b
No data available

Phenotype of all Fish created by or utilizing MO2-foxj1b
No data available
Genome Resources:
CITATIONS (1)