Morpholino

MO1-foxj1b

ID

ZDB-MRPHLNO-090513-3

Name

MO1-foxj1b

Previous Names

None

Target

foxj1b (1)

Sequence

5' - GTGTATGTCTCTTCAGTCCGTTA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Designed to target the 5' UTR region of foxj1b to block normal translation of the protein.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-foxj1b

Expressed Gene	Anatomy	Figures
cp	liver	Fig. 1 from Tian et al., 2009
lft2	heart rudiment	Fig. 1, Fig. 2 from Tian et al., 2009
pitx2	lateral plate mesoderm	Fig. 1, Fig. 2 from Tian et al., 2009
spaw	lateral plate mesoderm	Fig. 1, Fig. 2 from Tian et al., 2009
tpm4a	heart heart tube	Fig. 1, Fig. 2 from Tian et al., 2009

Phenotype

Phenotype resulting from MO1-foxj1b

Phenotype	Fish	Figures
brain hydrocephalic, abnormal	TU + MO1-foxj1b	Fig. S3 from Tian et al., 2009
determination of left/right symmetry disrupted, abnormal	TU + MO1-foxj1b	Fig. 1 from Tian et al., 2009
embryo development delayed, abnormal	TU + MO1-foxj1b	Fig. S3 from Tian et al., 2009
heart centered, abnormal	TU + MO1-foxj1b	Fig. 1 from Tian et al., 2009
heart right side of whole organism anterior-posterior axis, abnormal	TU + MO1-foxj1b	Fig. 1 from Tian et al., 2009
heart jogging disrupted, abnormal	TU + MO1-foxj1b	Fig. 1 from Tian et al., 2009
heart looping disrupted, abnormal	TU + MO1-foxj1b	Fig. 1 from Tian et al., 2009
heart rudiment bilateral, abnormal	TU + MO1-foxj1b	Fig. 1 from Tian et al., 2009
heart rudiment right side of whole organism anterior-posterior axis, abnormal	TU + MO1-foxj1b	Fig. 1 from Tian et al., 2009
liver bilateral, abnormal	TU + MO1-foxj1b	Fig. 1 from Tian et al., 2009
liver right side of whole organism anterior-posterior axis, abnormal	TU + MO1-foxj1b	Fig. 1 from Tian et al., 2009
pericardium dilated, abnormal	TU + MO1-foxj1b	Fig. S3 from Tian et al., 2009
post-vent region curved, abnormal	TU + MO1-foxj1b	Fig. S3 from Tian et al., 2009
somite loose, abnormal	TU + MO1-foxj1b	Fig. S3 from Tian et al., 2009

Phenotype of all Fish created by or utilizing MO1-foxj1b

Phenotype	Fish	Conditions	Figures
liver right side of whole organism anterior-posterior axis, abnormal	TU + MO1-foxj1b	standard conditions	Fig. 1 from Tian et al., 2009
liver bilateral, abnormal	TU + MO1-foxj1b	standard conditions	Fig. 1 from Tian et al., 2009
heart jogging disrupted, abnormal	TU + MO1-foxj1b	standard conditions	Fig. 1 from Tian et al., 2009
heart rudiment bilateral, abnormal	TU + MO1-foxj1b	standard conditions	Fig. 1 from Tian et al., 2009
heart looping disrupted, abnormal	TU + MO1-foxj1b	standard conditions	Fig. 1 from Tian et al., 2009
heart right side of whole organism anterior-posterior axis, abnormal	TU + MO1-foxj1b	standard conditions	Fig. 1 from Tian et al., 2009
post-vent region curved, abnormal	TU + MO1-foxj1b	standard conditions	Fig. S3 from Tian et al., 2009
pericardium dilated, abnormal	TU + MO1-foxj1b	standard conditions	Fig. S3 from Tian et al., 2009
somite loose, abnormal	TU + MO1-foxj1b	standard conditions	Fig. S3 from Tian et al., 2009
determination of left/right symmetry disrupted, abnormal	TU + MO1-foxj1b	standard conditions	Fig. 1 from Tian et al., 2009
embryo development delayed, abnormal	TU + MO1-foxj1b	standard conditions	Fig. S3 from Tian et al., 2009
heart centered, abnormal	TU + MO1-foxj1b	standard conditions	Fig. 1 from Tian et al., 2009
brain hydrocephalic, abnormal	TU + MO1-foxj1b	standard conditions	Fig. S3 from Tian et al., 2009
heart rudiment right side of whole organism anterior-posterior axis, abnormal	TU + MO1-foxj1b	standard conditions	Fig. 1 from Tian et al., 2009

Citations