header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-090513-3
Morpholino Name: MO1-foxj1b
Target: foxj1b (1)
Sequence:
5' - GTGTATGTCTCTTCAGTCCGTTA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Designed to target the 5' UTR region of foxj1b to block normal translation of the protein.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-foxj1b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-foxj1b
Expressed Gene Anatomy Figures
cp Fig. 1 from Tian et al., 2009
lft2 Fig. 1Fig. 2 from Tian et al., 2009
pitx2 Fig. 1Fig. 2 from Tian et al., 2009
spaw Fig. 1Fig. 2 from Tian et al., 2009
tpm4a Fig. 1Fig. 2 from Tian et al., 2009
PHENOTYPE
Phenotype resulting from MO1-foxj1b
Phenotype of all Fish created by or utilizing MO1-foxj1b
Phenotype Fish Conditions Figures
liver right side of whole organism anterior-posterior axis, abnormal TU + MO1-foxj1b standard conditions Fig. 1 from Tian et al., 2009
liver bilateral, abnormal TU + MO1-foxj1b standard conditions Fig. 1 from Tian et al., 2009
heart jogging disrupted, abnormal TU + MO1-foxj1b standard conditions Fig. 1 from Tian et al., 2009
heart looping disrupted, abnormal TU + MO1-foxj1b standard conditions Fig. 1 from Tian et al., 2009
heart rudiment bilateral, abnormal TU + MO1-foxj1b standard conditions Fig. 1 from Tian et al., 2009
heart right side of whole organism anterior-posterior axis, abnormal TU + MO1-foxj1b standard conditions Fig. 1 from Tian et al., 2009
post-vent region curved, abnormal TU + MO1-foxj1b standard conditions Fig. S3 from Tian et al., 2009
pericardium dilated, abnormal TU + MO1-foxj1b standard conditions Fig. S3 from Tian et al., 2009
somite loose, abnormal TU + MO1-foxj1b standard conditions Fig. S3 from Tian et al., 2009
determination of left/right symmetry disrupted, abnormal TU + MO1-foxj1b standard conditions Fig. 1 from Tian et al., 2009
embryo development delayed, abnormal TU + MO1-foxj1b standard conditions Fig. S3 from Tian et al., 2009
heart centered, abnormal TU + MO1-foxj1b standard conditions Fig. 1 from Tian et al., 2009
brain hydrocephalic, abnormal TU + MO1-foxj1b standard conditions Fig. S3 from Tian et al., 2009
heart rudiment right side of whole organism anterior-posterior axis, abnormal TU + MO1-foxj1b standard conditions Fig. 1 from Tian et al., 2009
Genome Resources:
CITATIONS (1)