Morpholino
MO1-rhcgb
- ID
- ZDB-MRPHLNO-090511-1
- Name
- MO1-rhcgb
- Previous Names
-
- MO1-rhcgl2
- rhcg1-MO (1)
- Target
- Sequence
-
5' - CAGTTGCCCATGTCTACAGCTTGAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rhcgb
No data available
Phenotype
Phenotype resulting from MO1-rhcgb
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO1-rhcgb
1 - 4 of 4
Citations
- Zimmer, A.M., Perry, S.F. (2020) The Rhesus glycoprotein Rhcgb is expendable for ammonia excretion and Na+ uptake in zebrafish (Danio rerio). Comparative biochemistry and physiology. Part A, Molecular & integrative physiology. 247:110722
- Shih, T.H., Horng, J.L., Lai, Y.T., and Lin, L.Y. (2013) Rhcg1 and Rhbg mediate ammonia excretion by ionocytes and keratinocytes in the skin of zebrafish larvae: H+-ATPase-linked active ammonia excretion by ionocytes. American journal of physiology. Regulatory, integrative and comparative physiology. 304(12):R1130-8
- Shih, T.H., Horng, J.L., Liu, S.T., Hwang, P.P., and Lin, L.Y. (2012) Rhcg1 and NHE3b are involved in ammonium-dependent sodium uptake by zebrafish larvae acclimated to low-sodium water. American journal of physiology. Regulatory, integrative and comparative physiology. 302(1):R84-93
- Shih, T.H., Horng, J.L., Hwang, P.P., and Lin, L.Y. (2008) Ammonia excretion by the skin of zebrafish (Danio rerio) larvae. American journal of physiology. Cell physiology. 295(6):C1625-C1632
1 - 4 of 4
Show