Morpholino

MO1-cep131

ID

ZDB-MRPHLNO-090508-1

Name

MO1-cep131

Previous Names

MOzcep131st (1)

Target

cep131 (1)

Sequence

5' - ATGGACTGCGGGTTGTATGCATCTT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-cep131

No data available

Phenotype

Phenotype resulting from MO1-cep131

Phenotype	Fish	Figures
central canal cilium decreased length, abnormal	WT + MO1-cep131	Fig. 4 from Wilkinson et al., 2009
determination of left/right symmetry disrupted, abnormal	WT + MO1-cep131	Fig. 5 from Wilkinson et al., 2009
Kupffer's vesicle morphology, abnormal	WT + MO1-cep131	Fig. 6 from Chamling et al., 2014
liver inverted, abnormal	WT + MO1-cep131	Fig. 5 from Wilkinson et al., 2009
melanosome transport delayed, abnormal	WT + MO1-cep131	Fig. 6 from Chamling et al., 2014
otolith mislocalised, abnormal	WT + MO1-cep131	Fig. 1 from Wilkinson et al., 2009
otolith organ has extra parts of type otolith, abnormal	WT + MO1-cep131	Fig. 1 from Wilkinson et al., 2009
parapineal organ inverted, abnormal	WT + MO1-cep131	Fig. 5 from Wilkinson et al., 2009
pronephric duct cilium decreased length, abnormal	WT + MO1-cep131	Fig. 4 from Wilkinson et al., 2009
startle response disrupted, abnormal	WT + MO1-cep131	Fig. 6 from Chamling et al., 2014
trunk curved, abnormal	WT + MO1-cep131	Fig. 6 from Chamling et al., 2014
visual behavior disrupted, abnormal	WT + MO1-cep131	Fig. 6 from Chamling et al., 2014
whole organism curved ventral, abnormal	WT + MO1-cep131	Fig. 1 from Wilkinson et al., 2009
whole organism decreased length, abnormal	WT + MO1-cep131	Fig. 1 from Wilkinson et al., 2009

Phenotype of all Fish created by or utilizing MO1-cep131

Phenotype	Fish	Conditions	Figures
determination of left/right symmetry disrupted, abnormal	WT + MO1-cep131	standard conditions	Fig. 5 from Wilkinson et al., 2009
visual behavior disrupted, abnormal	WT + MO1-cep131	standard conditions	Fig. 6 from Chamling et al., 2014
parapineal organ inverted, abnormal	WT + MO1-cep131	standard conditions	Fig. 5 from Wilkinson et al., 2009
Kupffer's vesicle morphology, abnormal	WT + MO1-cep131	standard conditions	Fig. 6 from Chamling et al., 2014
whole organism curved ventral, abnormal	WT + MO1-cep131	standard conditions	Fig. 1 from Wilkinson et al., 2009
liver inverted, abnormal	WT + MO1-cep131	standard conditions	Fig. 5 from Wilkinson et al., 2009
otolith mislocalised, abnormal	WT + MO1-cep131	standard conditions	Fig. 1 from Wilkinson et al., 2009
melanosome transport delayed, abnormal	WT + MO1-cep131	standard conditions	Fig. 6 from Chamling et al., 2014
trunk curved, abnormal	WT + MO1-cep131	standard conditions	Fig. 6 from Chamling et al., 2014
central canal cilium decreased length, abnormal	WT + MO1-cep131	standard conditions	Fig. 4 from Wilkinson et al., 2009
whole organism decreased length, abnormal	WT + MO1-cep131	standard conditions	Fig. 1 from Wilkinson et al., 2009
pronephric duct cilium decreased length, abnormal	WT + MO1-cep131	standard conditions	Fig. 4 from Wilkinson et al., 2009
otolith organ has extra parts of type otolith, abnormal	WT + MO1-cep131	standard conditions	Fig. 1 from Wilkinson et al., 2009
startle response disrupted, abnormal	WT + MO1-cep131	standard conditions	Fig. 6 from Chamling et al., 2014

Citations