Morpholino

MO1-tert

ID
ZDB-MRPHLNO-090505-1
Name
MO1-tert
Previous Names
None
Target
Sequence
5' - CTGTCGAGTACTGTCCAGACATCTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tert
Expressed Gene Anatomy Figures
alas2 Fig. 3 with image from Imamura et al., 2008
cdkn1a Fig. 5 with image from Imamura et al., 2008
gata1a Fig. 3 with image from Imamura et al., 2008
gata2a Fig. 3 with image from Imamura et al., 2008
hbbe3 Fig. 3 with image from Imamura et al., 2008
hspa9 Fig. 5 with image from Imamura et al., 2008
kdrl Fig. 3 with image from Imamura et al., 2008
lcp1 Fig. 3 with image from Imamura et al., 2008
lmo2 Fig. 3 with image from Imamura et al., 2008
mdm2 Fig. 5 with image from Imamura et al., 2008
mpx Fig. 3 with image from Imamura et al., 2008
myb Fig. 3 with image,  Fig. 5 with image from Imamura et al., 2008
runx1 Fig. 3 with image,  Fig. 5 with image from Imamura et al., 2008
spi1b Fig. 3 with image from Imamura et al., 2008
tal1 Fig. 3 with image from Imamura et al., 2008
tp53 Fig. 5 with image from Imamura et al., 2008
Phenotype
Phenotype resulting from MO1-tert
Phenotype Fish Figures
blood cell absent, abnormal WT + MO1-tert Fig. 2 with image,  Fig. 5 with image from Imamura et al., 2008
blood cell apoptotic, abnormal la781Tg + MO1-tert Fig. 2 with image from Imamura et al., 2008
blood cell decreased amount, abnormal WT + MO1-tert Fig. 2 with image,  Fig. 5 with image,  text only from Imamura et al., 2008
caudal vein plexus apoptotic, abnormal WT + MO1-tert Fig. 2 with image,  Fig. 5 with image from Imamura et al., 2008
head apoptotic, abnormal WT + MO1-tert Fig. 2 with image from Imamura et al., 2008
heme biosynthetic process disrupted, abnormal WT + MO1-tert Fig. 3 with image from Imamura et al., 2008
nucleate erythrocyte decreased amount, abnormal la781Tg + MO1-tert Fig. 2 with image,  Fig. 4 with image from Imamura et al., 2008
nucleate erythrocyte immature, abnormal la781Tg + MO1-tert Fig. 4 with image from Imamura et al., 2008
telomerase activity process quality, abnormal WT + MO1-tert Fig. 1 with image,  Fig. 4 with image from Imamura et al., 2008
trunk apoptotic, abnormal WT + MO1-tert Fig. 2 with image from Imamura et al., 2008
ventral wall of dorsal aorta apoptotic, abnormal WT + MO1-tert Fig. 2 with image from Imamura et al., 2008
whole organism hypoplastic, abnormal WT + MO1-tert text only from Imamura et al., 2008
Phenotype of all Fish created by or utilizing MO1-tert
Phenotype Fish Conditions Figures
trunk apoptotic, abnormal WT + MO1-tert standard conditions Fig. 2 with image from Imamura et al., 2008
blood cell absent, abnormal WT + MO1-tert standard conditions Fig. 2 with image,  Fig. 5 with image from Imamura et al., 2008
caudal vein plexus apoptotic, abnormal WT + MO1-tert standard conditions Fig. 2 with image,  Fig. 5 with image from Imamura et al., 2008
blood cell decreased amount, abnormal WT + MO1-tert standard conditions Fig. 2 with image,  text only from Imamura et al., 2008
nucleate erythrocyte decreased amount, abnormal WT + MO1-tert standard conditions Fig. 2 with image from Imamura et al., 2008
head apoptotic, abnormal WT + MO1-tert standard conditions Fig. 2 with image from Imamura et al., 2008
whole organism hypoplastic, abnormal WT + MO1-tert standard conditions text only from Imamura et al., 2008
ventral wall of dorsal aorta apoptotic, abnormal WT + MO1-tert standard conditions Fig. 2 with image from Imamura et al., 2008
telomerase activity process quality, abnormal WT + MO1-tert standard conditions Fig. 1 with image from Imamura et al., 2008
blood cell apoptotic, abnormal WT + MO1-tert standard conditions Fig. 2 with image from Imamura et al., 2008
heme biosynthetic process disrupted, abnormal WT + MO1-tert standard conditions Fig. 3 with image from Imamura et al., 2008
blood cell decreased amount, abnormal WT + MO1-tert + MO4-tp53 standard conditions Fig. 5 with image from Imamura et al., 2008
telomerase activity process quality, abnormal la781Tg + MO1-tert standard conditions Fig. 4 with image from Imamura et al., 2008
nucleate erythrocyte decreased amount, abnormal la781Tg + MO1-tert standard conditions Fig. 4 with image from Imamura et al., 2008
caudal vein plexus apoptotic, abnormal la781Tg + MO1-tert standard conditions Fig. 2 with image from Imamura et al., 2008
nucleate erythrocyte immature, abnormal la781Tg + MO1-tert standard conditions Fig. 4 with image from Imamura et al., 2008
blood cell apoptotic, abnormal la781Tg + MO1-tert standard conditions Fig. 2 with image from Imamura et al., 2008
blood cell decreased amount, abnormal tp53zdf1/zdf1 + MO1-tert standard conditions text only from Imamura et al., 2008
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.