ZFIN ID: ZDB-MRPHLNO-090429-2
Morpholino Name: MO2-prdm5
Target: prdm5 (1)
Previous Name: SBmo prdm5

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TTATAGGCACGAACCTTCTTGACTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-prdm5 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-prdm5
Expressed Gene Anatomy Figures
ctslb Fig. 4 with image from Meani et al., 2009
dlx3b Fig. 4 with image from Meani et al., 2009
pax2a Fig. 4 with image from Meani et al., 2009
tbxta Fig. 4 with image from Meani et al., 2009
PHENOTYPE
Phenotype resulting from MO2-prdm5
Phenotype of all Fish created by or utilizing MO2-prdm5
Genome Resources:
CITATIONS (1)