Morpholino
MO1-ift172
- ID
- ZDB-MRPHLNO-090428-8
- Name
- MO1-ift172
- Previous Names
-
- hi2211 oligo 2 (1)
- Target
- Sequence
-
5' - GACTCAGGGCAGTTATAAGAACGTA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ift172
No data available
Phenotype
Phenotype resulting from MO1-ift172
1 - 5 of 9 Show all
Phenotype of all Fish created by or utilizing MO1-ift172
1 - 5 of 15 Show all
Citations
- Zhao, L., Yuan, S., Cao, Y., Kallakuri, S., Li, Y., Kishimoto, N., Dibella, L., and Sun, Z. (2013) Reptin/Ruvbl2 is a Lrrc6/Seahorse interactor essential for cilia motility. Proceedings of the National Academy of Sciences of the United States of America. 110(31):12697-702
- Li, J., and Sun, Z. (2011) Qilin is essential for cilia assembly and normal kidney development in zebrafish. PLoS One. 6(11):e27365
- Cao, Y., Park, A., and Sun, Z. (2010) Intraflagellar Transport Proteins Are Essential for Cilia Formation and for Planar Cell Polarity. Journal of the American Society of Nephrology : JASN. 21(8):1326-1333
- Dibella, L.M., Park, A., and Sun, Z. (2009) Zebrafish Tsc1 Reveals Functional Interactions Between the Cilium and the TOR Pathway. Human molecular genetics. 18(4):595-606
- Lunt, S.C., Haynes, T., and Perkins, B.D. (2009) Zebrafish ift57, ift88, and ift172 intraflagellar transport mutants disrupt cilia but do not affect hedgehog signaling. Developmental Dynamics : an official publication of the American Association of Anatomists. 238(7):1744-1759
- Sun, Z., Amsterdam, A., Pazour, G.J., Cole, D.G., Miller, M.S. and Hopkins, N. (2004) A Genetic Screen in Zebrafish Identifies Cilia Genes as a Principal Cause of Cystic Kidney Development. Development (Cambridge, England). 131(16):4085-4093
1 - 6 of 6
Show