Morpholino

MO1-ift172

ID
ZDB-MRPHLNO-090428-8
Name
MO1-ift172
Previous Names
  • hi2211 oligo 2 (1)
Target
Sequence
5' - GACTCAGGGCAGTTATAAGAACGTA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ift172
Expressed Gene Anatomy Figures
ptch2 Fig. 9 with image from Lunt et al., 2009
Phenotype
Phenotype resulting from MO1-ift172
Phenotype Fish Figures
cilium assembly disrupted, abnormal WT + MO1-ift172 Fig. 2 with image from Lunt et al., 2009
neural tube axoneme absent, abnormal WT + MO1-ift172 Fig. 2 with image from Lunt et al., 2009
otic vesicle decreased size, abnormal WT + MO1-ift172 Fig. 2 with image from Lunt et al., 2009
otic vesicle cilium decreased amount, abnormal WT + MO1-ift172 Fig. 2 with image from Lunt et al., 2009
otic vesicle cilium decreased length, abnormal WT + MO1-ift172 Fig. 2 with image from Lunt et al., 2009
post-vent region curved ventral, abnormal WT + MO1-ift172 Fig. 3 from Dibella et al., 2009
post-vent region increased curvature, abnormal WT + MO1-ift172 Table 2 from Sun et al., 2004
pronephros cystic, abnormal WT + MO1-ift172 Fig. 3 from Dibella et al., 2009
Table 2 from Sun et al., 2004
trunk curved ventral, abnormal AB/TU + MO1-ift172 Fig. 7 with image from Li et al., 2011
Phenotype of all Fish created by or utilizing MO1-ift172
Phenotype Fish Conditions Figures
trunk curved ventral, abnormal AB/TU + MO1-ift172 standard conditions Fig. 7 with image from Li et al., 2011
cilium assembly disrupted, abnormal WT + MO1-ift172 standard conditions Fig. 2 with image from Lunt et al., 2009
neural tube axoneme absent, abnormal WT + MO1-ift172 standard conditions Fig. 2 with image from Lunt et al., 2009
post-vent region curved ventral, abnormal WT + MO1-ift172 standard conditions Fig. 3 from Dibella et al., 2009
otic vesicle cilium decreased amount, abnormal WT + MO1-ift172 standard conditions Fig. 2 with image from Lunt et al., 2009
otic vesicle decreased size, abnormal WT + MO1-ift172 standard conditions Fig. 2 with image from Lunt et al., 2009
pronephros cystic, abnormal WT + MO1-ift172 standard conditions Fig. 3 from Dibella et al., 2009
Table 2 from Sun et al., 2004
post-vent region increased curvature, abnormal WT + MO1-ift172 standard conditions Table 2 from Sun et al., 2004
otic vesicle cilium decreased length, abnormal WT + MO1-ift172 standard conditions Fig. 2 with image from Lunt et al., 2009
trunk curved ventral, abnormal AB/TU + MO1-ift172 + MO3-cluap1 standard conditions Fig. 7 with image from Li et al., 2011
post-vent region curved ventral, abnormal WT + MO1-ift172 + MO1-ruvbl2 standard conditions Fig. S3 with image from Zhao et al., 2013
trunk curved ventral, abnormal WT + MO1-ift172 + MO1-ruvbl2 standard conditions Fig. S3 with image from Zhao et al., 2013
pronephros cystic, abnormal WT + MO1-ift172 + MO1-ruvbl2 standard conditions Fig. S3 with image from Zhao et al., 2013
pronephros cystic, abnormal WT + MO1-ift172 + MO1-tsc1a standard conditions Fig. 3 from Dibella et al., 2009
post-vent region curved ventral, abnormal WT + MO1-ift172 + MO1-tsc1a standard conditions Fig. 3 from Dibella et al., 2009
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.