header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-090213-1
Morpholino Name: MO1-foxj1a
Target: foxj1a (1)
Previous Name: Foxj1MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CATGGAGAGCATGGTCCTGACAAAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Morpholino targets the start codon of foxj1a.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-foxj1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-foxj1a No data available
PHENOTYPE
Phenotype resulting from MO1-foxj1a
Phenotype of all Fish created by or utilizing MO1-foxj1a
OTHER MO1-foxj1a MORPHOLINO PAGESNo links to external sites
CITATIONS (2)