Community Action Needed: Please respond to the NIH RFI
Morpholino

MO1-sh3gl1b

ID
ZDB-MRPHLNO-090211-2
Name
MO1-sh3gl1b
Previous Names
None
Target
Sequence
5' - CTTCTTTAAGCCCGCCACGGACATC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-sh3gl1b
Phenotype
Phenotype resulting from MO1-sh3gl1b
No data available
Phenotype of all Fish created by or utilizing MO1-sh3gl1b
No data available
Citations