Morpholino

MO1-lpar1

ID
ZDB-MRPHLNO-090126-5
Name
MO1-lpar1
Previous Names
  • LPA1 MO (1)
  • zlpa1 sMO1 (1)
Target
Sequence
5' - TGGAGCACTTACCCAATACAATCAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking morpholino targeting the boundary between exon 2 and intron 2.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-lpar1
Expressed Gene Anatomy Figures
lpar1 Fig. 3 from Lee et al., 2008
Phenotype
Phenotype resulting from MO1-lpar1
Phenotype Fish Figures
blood circulation disrupted, abnormal AB + MO1-lpar1 text only from Lee et al., 2008
cardiovascular system morphology, abnormal y1Tg + MO1-lpar1 Fig. 5 from Lee et al., 2008
cardiovascular system non-functional, abnormal AB + MO1-lpar1 Fig. 4,  text only from Lee et al., 2008
cartilage development process quality, abnormal AB + MO1-lpar1 Fig. 1 with image from Nishioka et al., 2016
ceratohyal cartilage deformed, abnormal AB + MO1-lpar1 Fig. 1 with image from Nishioka et al., 2016
ceratohyal cartilage chondrocyte disorganized, abnormal zf678Tg + MO1-lpar1 Fig. 1 with image from Nishioka et al., 2016
ceratohyal cartilage chondrocyte increased variability of size, abnormal zf678Tg + MO1-lpar1 Fig. 1 with image from Nishioka et al., 2016
cranium malformed, abnormal AB + MO1-lpar1 Fig. 1 with image,  Fig. S1 with image from Nishioka et al., 2016
dorsal longitudinal anastomotic vessel irregular spatial pattern, abnormal y1Tg + MO1-lpar1 text only from Lee et al., 2008
gut edematous, abnormal AB + MO1-lpar1 Fig. 4 from Lee et al., 2008
head circular, abnormal AB + MO1-lpar1 Fig. 1 with image from Nishioka et al., 2016
heart contraction disrupted, abnormal AB + MO1-lpar1 text only from Lee et al., 2008
intersegmental artery decreased length, abnormal y1Tg + MO1-lpar1 (AB) Fig. 8 from Yukiura et al., 2011
intersegmental vessel irregular spatial pattern, abnormal y1Tg + MO1-lpar1 text only from Lee et al., 2008
lymphangiogenesis disrupted, abnormal y1Tg + MO1-lpar1 Fig. 5,  Fig. 6,  text only from Lee et al., 2008
Meckel's cartilage deformed, abnormal AB + MO1-lpar1 Fig. 1 with image from Nishioka et al., 2016
Meckel's cartilage chondrocyte disorganized, abnormal zf678Tg + MO1-lpar1 Fig. 1 with image from Nishioka et al., 2016
Meckel's cartilage chondrocyte increased variability of size, abnormal zf678Tg + MO1-lpar1 Fig. 1 with image from Nishioka et al., 2016
pericardium edematous, abnormal AB + MO1-lpar1 Fig. 4 from Lee et al., 2008
subintestinal vein irregular spatial pattern, abnormal y1Tg + MO1-lpar1 text only from Lee et al., 2008
supraintestinal artery irregular spatial pattern, abnormal y1Tg + MO1-lpar1 text only from Lee et al., 2008
thoracic duct aplastic, abnormal y1Tg + MO1-lpar1 Fig. 5,  Fig. 6,  text only from Lee et al., 2008
thoracic duct decreased size, abnormal y1Tg + MO1-lpar1 Fig. 6 from Lee et al., 2008
trunk edematous, abnormal AB + MO1-lpar1 Fig. 4,  text only from Lee et al., 2008
Phenotype of all Fish created by or utilizing MO1-lpar1
Phenotype Fish Conditions Figures
cardiovascular system non-functional, abnormal AB + MO1-lpar1 standard conditions Fig. 4,  text only from Lee et al., 2008
blood circulation disrupted, abnormal AB + MO1-lpar1 standard conditions text only from Lee et al., 2008
cranium malformed, abnormal AB + MO1-lpar1 standard conditions Fig. 1 with image from Nishioka et al., 2016
Meckel's cartilage deformed, abnormal AB + MO1-lpar1 standard conditions Fig. 1 with image from Nishioka et al., 2016
gut edematous, abnormal AB + MO1-lpar1 standard conditions Fig. 4 from Lee et al., 2008
trunk edematous, abnormal AB + MO1-lpar1 standard conditions Fig. 4 from Lee et al., 2008
pericardium edematous, abnormal AB + MO1-lpar1 standard conditions Fig. 4 from Lee et al., 2008
cartilage development process quality, abnormal AB + MO1-lpar1 standard conditions Fig. 1 with image from Nishioka et al., 2016
ceratohyal cartilage deformed, abnormal AB + MO1-lpar1 standard conditions Fig. 1 with image from Nishioka et al., 2016
head circular, abnormal AB + MO1-lpar1 standard conditions Fig. 1 with image from Nishioka et al., 2016
heart contraction disrupted, abnormal AB + MO1-lpar1 standard conditions text only from Lee et al., 2008
thoracic duct decreased size, abnormal y1Tg + MO1-lpar1 standard conditions Fig. 6 from Lee et al., 2008
subintestinal vein irregular spatial pattern, abnormal y1Tg + MO1-lpar1 standard conditions text only from Lee et al., 2008
lymphangiogenesis disrupted, abnormal y1Tg + MO1-lpar1 standard conditions Fig. 5,  Fig. 6,  text only from Lee et al., 2008
supraintestinal artery irregular spatial pattern, abnormal y1Tg + MO1-lpar1 standard conditions text only from Lee et al., 2008
thoracic duct aplastic, abnormal y1Tg + MO1-lpar1 standard conditions Fig. 5,  Fig. 6,  text only from Lee et al., 2008
trunk edematous, abnormal y1Tg + MO1-lpar1 standard conditions text only from Lee et al., 2008
intersegmental vessel irregular spatial pattern, abnormal y1Tg + MO1-lpar1 standard conditions text only from Lee et al., 2008
dorsal longitudinal anastomotic vessel irregular spatial pattern, abnormal y1Tg + MO1-lpar1 standard conditions text only from Lee et al., 2008
cardiovascular system morphology, abnormal y1Tg + MO1-lpar1 standard conditions Fig. 5 from Lee et al., 2008
intersegmental artery decreased length, abnormal y1Tg + MO1-lpar1 (AB) standard conditions Fig. 8 from Yukiura et al., 2011
ceratohyal cartilage chondrocyte disorganized, abnormal zf678Tg + MO1-lpar1 standard conditions Fig. 1 with image from Nishioka et al., 2016
ceratohyal cartilage chondrocyte increased variability of size, abnormal zf678Tg + MO1-lpar1 standard conditions Fig. 1 with image from Nishioka et al., 2016
cranium malformed, abnormal zf678Tg + MO1-lpar1 standard conditions Fig. S1 with image from Nishioka et al., 2016
Meckel's cartilage chondrocyte disorganized, abnormal zf678Tg + MO1-lpar1 standard conditions Fig. 1 with image from Nishioka et al., 2016
Meckel's cartilage chondrocyte increased variability of size, abnormal zf678Tg + MO1-lpar1 standard conditions Fig. 1 with image from Nishioka et al., 2016
intersegmental artery attached to intersegmental vessel, abnormal y1Tg + MO1-lpar1 + MO1-lpar4 (AB) standard conditions Fig. 8 from Yukiura et al., 2011
intersegmental artery dissociated from dorsal aorta, abnormal y1Tg + MO1-lpar1 + MO1-lpar4 (AB) standard conditions Fig. 8 from Yukiura et al., 2011
intersegmental vessel decreased length, abnormal y1Tg + MO1-lpar1 + MO1-lpar4 (AB) standard conditions Fig. 8 from Yukiura et al., 2011
intersegmental artery decreased length, abnormal y1Tg + MO1-lpar1 + MO1-lpar4 (AB) standard conditions Fig. 8 from Yukiura et al., 2011
intersegmental artery decreased length, abnormal y1Tg + MO1-lpar1 + MO2-lpar4 (AB) standard conditions Fig. S5 from Yukiura et al., 2011
angiogenesis disrupted, abnormal y1Tg + MO1-lpar1 + MO2-lpar4 (AB) standard conditions Fig. S5 from Yukiura et al., 2011
intersegmental artery attached to intersegmental vessel, abnormal y1Tg + MO1-lpar1 + MO2-lpar4 (AB) standard conditions Fig. S5 from Yukiura et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.