ZFIN ID: ZDB-MRPHLNO-090116-1
Morpholino Name: MO1-hnf1ba
Target: hnf1ba (1)
Previous Names: MO1-hnf1b (1), tcf2 MO

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CTAGAGAGGGAAATGCGGTATTGTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-hnf1ba No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-hnf1ba No data available
PHENOTYPE
Phenotype resulting from MO1-hnf1ba
No data available

Phenotype of all Fish created by or utilizing MO1-hnf1ba
No data available
OTHER MO1-hnf1ba MORPHOLINO PAGESNo links to external sites
CITATIONS (3)