Community Action Needed: Please respond to the NIH RFI
Morpholino

MO1-cdh7a

ID
ZDB-MRPHLNO-090108-3
Name
MO1-cdh7a
Previous Names
  • ATG MO (1)
  • MO1-cdh7
Target
Sequence
5' - GCCAACAGCAGTATAGTCATTACAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking morpholino
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cdh7a
Phenotype
Phenotype resulting from MO1-cdh7a
Phenotype of all Fish created by or utilizing MO1-cdh7a
Citations