Morpholino

MO1-dusp4

ID
ZDB-MRPHLNO-081229-7
Name
MO1-dusp4
Previous Names
None
Target
Sequence
5' - TAGCCCCCTGTAAAAGTGGAAAAGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking morpholino
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dusp4
Expressed Gene Anatomy Figures
foxa2 Fig. 6 with image from van Boxtel et al., 2017
Fig. 3 from Brown et al., 2008
ins Fig. 3 from Brown et al., 2008
noto Fig. 6 with image from van Boxtel et al., 2017
sox17 Fig. 6 with image from van Boxtel et al., 2017
Fig. 3 from Brown et al., 2008
Phenotype
Phenotype resulting from MO1-dusp4
Phenotype Fish Figures
embryo development delayed, abnormal WT + MO1-dusp4 Fig. 3 from Brown et al., 2008
endoderm morphology, abnormal WT + MO1-dusp4 Fig. 3 from Brown et al., 2008
endoderm development disrupted, abnormal WT + MO1-dusp4 Fig. 3 from Brown et al., 2008
endodermal cell foxa2 expression decreased amount, abnormal WT + MO1-dusp4 Fig. 6 with image from van Boxtel et al., 2017
endodermal cell sox17 expression decreased amount, abnormal WT + MO1-dusp4 Fig. 6 with image from van Boxtel et al., 2017
endodermal cell increased amount, abnormal WT + MO1-dusp4 Fig. 6 with image from van Boxtel et al., 2017
gut morphology, abnormal WT + MO1-dusp4 Fig. 3 from Brown et al., 2008
head decreased size, abnormal WT + MO1-dusp4 Fig. 3 from Brown et al., 2008
head necrotic, abnormal WT + MO1-dusp4 Fig. 3 from Brown et al., 2008
pancreatic bud morphology, abnormal WT + MO1-dusp4 Fig. 3 from Brown et al., 2008
whole organism decreased length, abnormal WT + MO1-dusp4 Fig. 3 from Brown et al., 2008
whole organism noto expression increased amount, abnormal WT + MO1-dusp4 Fig. 6 with image from van Boxtel et al., 2017
Phenotype of all Fish created by or utilizing MO1-dusp4
Phenotype Fish Conditions Figures
pancreatic bud morphology, abnormal WT + MO1-dusp4 standard conditions Fig. 3 from Brown et al., 2008
endodermal cell increased amount, abnormal WT + MO1-dusp4 standard conditions Fig. 6 with image from van Boxtel et al., 2017
endodermal cell foxa2 expression decreased amount, abnormal WT + MO1-dusp4 standard conditions Fig. 6 with image from van Boxtel et al., 2017
endoderm development disrupted, abnormal WT + MO1-dusp4 standard conditions Fig. 3 from Brown et al., 2008
whole organism noto expression increased amount, abnormal WT + MO1-dusp4 standard conditions Fig. 6 with image from van Boxtel et al., 2017
head decreased size, abnormal WT + MO1-dusp4 standard conditions Fig. 3 from Brown et al., 2008
embryo development delayed, abnormal WT + MO1-dusp4 standard conditions Fig. 3 from Brown et al., 2008
endoderm morphology, abnormal WT + MO1-dusp4 standard conditions Fig. 3 from Brown et al., 2008
endodermal cell sox17 expression decreased amount, abnormal WT + MO1-dusp4 standard conditions Fig. 6 with image from van Boxtel et al., 2017
gut morphology, abnormal WT + MO1-dusp4 standard conditions Fig. 3 from Brown et al., 2008
whole organism decreased length, abnormal WT + MO1-dusp4 standard conditions Fig. 3 from Brown et al., 2008
head necrotic, abnormal WT + MO1-dusp4 standard conditions Fig. 3 from Brown et al., 2008
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.