Morpholino

MO1-hif1ab

ID
ZDB-MRPHLNO-081120-4
Name
MO1-hif1ab
Previous Names
None
Target
Sequence
5' - ACCCTACAAAAGAAAGAAGGAGAGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hif1ab
Expressed Gene Anatomy Figures
myb Fig. 3 from Lim et al., 2017
runx1 Fig. 3 from Lim et al., 2017
Phenotype
Phenotype resulting from MO1-hif1ab
Phenotype Fish Figures
muscle mitophagy decreased occurrence, abnormal zf3335Tg + MO1-hif1ab Fig. 6 from Wrighton et al., 2021
ventral wall of dorsal aorta hematopoietic stem cell myb expression decreased amount, abnormal WT + MO1-hif1ab Fig. 3 from Lim et al., 2017
ventral wall of dorsal aorta hematopoietic stem cell runx1 expression decreased amount, abnormal WT + MO1-hif1ab Fig. 3 from Lim et al., 2017
Phenotype of all Fish created by or utilizing MO1-hif1ab
Phenotype Fish Conditions Figures
ventral wall of dorsal aorta hematopoietic stem cell myb expression decreased amount, abnormal WT + MO1-hif1ab control Fig. 3 from Lim et al., 2017
ventral wall of dorsal aorta hematopoietic stem cell runx1 expression decreased amount, abnormal WT + MO1-hif1ab control Fig. 3 from Lim et al., 2017
muscle mitophagy decreased occurrence, abnormal zf3335Tg + MO1-hif1ab standard conditions Fig. 6 from Wrighton et al., 2021
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal WT + MO1-hif1aa + MO1-hif1ab heat shock Fig. 6 from Gerri et al., 2018
ventral wall of dorsal aorta myb expression decreased amount, abnormal WT + MO1-hif1aa + MO1-hif1ab standard conditions Fig. 6 from Gerri et al., 2018
hematopoietic system myb expression decreased amount, abnormal WT + MO1-hif1aa + MO1-hif1ab standard conditions Fig. 6 from Gerri et al., 2018
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal WT + MO1-hif1aa + MO1-hif1ab standard conditions Fig. 6 from Gerri et al., 2018
hematopoietic system runx1 expression decreased amount, abnormal WT + MO1-hif1aa + MO1-hif1ab standard conditions Fig. 6 from Gerri et al., 2018
ventral wall of dorsal aorta myb expression decreased amount, abnormal WT + MO1-hif1aa + MO1-hif1ab heat shock Fig. 6 from Gerri et al., 2018
hematopoietic system runx1 expression decreased amount, abnormal WT + MO1-hif1aa + MO1-hif1ab heat shock Fig. 6 from Gerri et al., 2018
hematopoietic system myb expression decreased amount, abnormal WT + MO1-hif1aa + MO1-hif1ab heat shock Fig. 6 from Gerri et al., 2018
ventral wall of dorsal aorta myb expression increased amount, abnormal kca3Tg; kca4Tg + MO1-hif1aa + MO1-hif1ab heat shock Fig. 6 from Gerri et al., 2018
ventral wall of dorsal aorta runx1 expression increased amount, abnormal kca3Tg; kca4Tg + MO1-hif1aa + MO1-hif1ab heat shock Fig. 6 from Gerri et al., 2018
hematopoietic system runx1 expression increased amount, abnormal kca3Tg; kca4Tg + MO1-hif1aa + MO1-hif1ab heat shock Fig. 6 from Gerri et al., 2018
hematopoietic system myb expression increased amount, abnormal kca3Tg; kca4Tg + MO1-hif1aa + MO1-hif1ab heat shock Fig. 6 from Gerri et al., 2018
ventral wall of dorsal aorta runx1 expression increased amount, abnormal kca3Tg; ubs4Tg + MO1-hif1aa + MO1-hif1ab standard conditions Fig. 6 from Gerri et al., 2018
ventral wall of dorsal aorta myb expression increased amount, abnormal kca3Tg; ubs4Tg + MO1-hif1aa + MO1-hif1ab standard conditions Fig. 6 from Gerri et al., 2018
hematopoietic system runx1 expression increased amount, abnormal kca3Tg; ubs4Tg + MO1-hif1aa + MO1-hif1ab standard conditions Fig. 6 from Gerri et al., 2018
hematopoietic system myb expression increased amount, abnormal kca3Tg; ubs4Tg + MO1-hif1aa + MO1-hif1ab standard conditions Fig. 6 from Gerri et al., 2018
ventral wall of dorsal aorta hematopoietic cell decreased amount, abnormal s896Tg; zf169Tg + MO1-hif1aa + MO1-hif1ab standard conditions Fig. 2 from Gerri et al., 2018
hematopoietic stem cell decreased amount, abnormal s896Tg; zf169Tg + MO1-hif1aa + MO1-hif1ab standard conditions Fig. 2 from Gerri et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.