Morpholino

MO1-hif1ab

ID

ZDB-MRPHLNO-081120-4

Name

MO1-hif1ab

Previous Names

None

Target

hif1ab (1)

Sequence

5' - ACCCTACAAAAGAAAGAAGGAGAGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-hif1ab

No data available

Phenotype

Phenotype resulting from MO1-hif1ab

Phenotype	Fish	Figures
muscle mitophagy decreased occurrence, abnormal	zf3335Tg + MO1-hif1ab	Fig. 6 from Wrighton et al., 2021
ventral wall of dorsal aorta hematopoietic stem cell myb expression decreased amount, abnormal	WT + MO1-hif1ab	Fig. 3 from Lim et al., 2017
ventral wall of dorsal aorta hematopoietic stem cell runx1 expression decreased amount, abnormal	WT + MO1-hif1ab	Fig. 3 from Lim et al., 2017

Phenotype of all Fish created by or utilizing MO1-hif1ab

Phenotype	Fish	Conditions	Figures
ventral wall of dorsal aorta hematopoietic stem cell myb expression decreased amount, abnormal	WT + MO1-hif1ab	control	Fig. 3 from Lim et al., 2017
ventral wall of dorsal aorta hematopoietic stem cell runx1 expression decreased amount, abnormal	WT + MO1-hif1ab	control	Fig. 3 from Lim et al., 2017
muscle mitophagy decreased occurrence, abnormal	zf3335Tg + MO1-hif1ab	standard conditions	Fig. 6 from Wrighton et al., 2021
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal	WT + MO1-hif1aa + MO1-hif1ab	heat shock	Fig. 6 from Gerri et al., 2018
ventral wall of dorsal aorta myb expression decreased amount, abnormal	WT + MO1-hif1aa + MO1-hif1ab	standard conditions	Fig. 6 from Gerri et al., 2018
hematopoietic system myb expression decreased amount, abnormal	WT + MO1-hif1aa + MO1-hif1ab	standard conditions	Fig. 6 from Gerri et al., 2018
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal	WT + MO1-hif1aa + MO1-hif1ab	standard conditions	Fig. 6 from Gerri et al., 2018
hematopoietic system runx1 expression decreased amount, abnormal	WT + MO1-hif1aa + MO1-hif1ab	standard conditions	Fig. 6 from Gerri et al., 2018
ventral wall of dorsal aorta myb expression decreased amount, abnormal	WT + MO1-hif1aa + MO1-hif1ab	heat shock	Fig. 6 from Gerri et al., 2018
hematopoietic system runx1 expression decreased amount, abnormal	WT + MO1-hif1aa + MO1-hif1ab	heat shock	Fig. 6 from Gerri et al., 2018
hematopoietic system myb expression decreased amount, abnormal	WT + MO1-hif1aa + MO1-hif1ab	heat shock	Fig. 6 from Gerri et al., 2018
ventral wall of dorsal aorta myb expression increased amount, abnormal	kca3Tg; kca4Tg + MO1-hif1aa + MO1-hif1ab	heat shock	Fig. 6 from Gerri et al., 2018
ventral wall of dorsal aorta runx1 expression increased amount, abnormal	kca3Tg; kca4Tg + MO1-hif1aa + MO1-hif1ab	heat shock	Fig. 6 from Gerri et al., 2018
hematopoietic system runx1 expression increased amount, abnormal	kca3Tg; kca4Tg + MO1-hif1aa + MO1-hif1ab	heat shock	Fig. 6 from Gerri et al., 2018
hematopoietic system myb expression increased amount, abnormal	kca3Tg; kca4Tg + MO1-hif1aa + MO1-hif1ab	heat shock	Fig. 6 from Gerri et al., 2018
ventral wall of dorsal aorta runx1 expression increased amount, abnormal	kca3Tg; ubs4Tg + MO1-hif1aa + MO1-hif1ab	standard conditions	Fig. 6 from Gerri et al., 2018
ventral wall of dorsal aorta myb expression increased amount, abnormal	kca3Tg; ubs4Tg + MO1-hif1aa + MO1-hif1ab	standard conditions	Fig. 6 from Gerri et al., 2018
hematopoietic system runx1 expression increased amount, abnormal	kca3Tg; ubs4Tg + MO1-hif1aa + MO1-hif1ab	standard conditions	Fig. 6 from Gerri et al., 2018
hematopoietic system myb expression increased amount, abnormal	kca3Tg; ubs4Tg + MO1-hif1aa + MO1-hif1ab	standard conditions	Fig. 6 from Gerri et al., 2018
ventral wall of dorsal aorta hematopoietic cell decreased amount, abnormal	s896Tg; zf169Tg + MO1-hif1aa + MO1-hif1ab	standard conditions	Fig. 2 from Gerri et al., 2018
hematopoietic stem cell decreased amount, abnormal	s896Tg; zf169Tg + MO1-hif1aa + MO1-hif1ab	standard conditions	Fig. 2 from Gerri et al., 2018

Citations