Morpholino
MO1-hif1ab
- ID
- ZDB-MRPHLNO-081120-4
- Name
- MO1-hif1ab
- Previous Names
- None
- Target
- Sequence
-
5' - ACCCTACAAAAGAAAGAAGGAGAGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hif1ab
No data available
Phenotype
Phenotype resulting from MO1-hif1ab
1 - 3 of 3
Phenotype of all Fish created by or utilizing MO1-hif1ab
1 - 5 of 21 Show all
Citations
- Li, X., Wang, L., Qin, X., Chen, X., Li, L., Huang, Z., Zhang, W., Liu, W. (2022) Estrogens revert neutrophil hyperplasia by inhibiting Hif1α-cMyb pathway in zebrafish myelodysplastic syndromes models. Cell death discovery. 8:323
- Wrighton, P.J., Shwartz, A., Heo, J.M., Quenzer, E.D., LaBella, K.A., Harper, J.W., Goessling, W. (2021) Quantitative intravital imaging reveals in vivo dynamics of physiological-stress induced mitophagy. Journal of Cell Science. 134(4):
- Dey, A., Prabhudesai, S., Zhang, Y., Rao, G., Thirugnanam, K., Hossen, M.N., Dwivedi, S.K.D., Ramchandran, R., Mukherjee, P., Bhattacharya, R. (2020) Cystathione β-synthase regulates HIF-1α stability through persulfidation of PHD2. Science advances. 6(27):
- Gerri, C., Marass, M., Rossi, A., Stainier, D.Y.R. (2018) Hif-1α and Hif-2α regulate hemogenic endothelium and hematopoietic stem cell formation in zebrafish. Blood. 131(9):963-973
- Gerri, C., Marín-Juez, R., Marass, M., Marks, A., Maischein, H.M., Stainier, D.Y.R. (2017) Hif-1α regulates macrophage-endothelial interactions during blood vessel development in zebrafish. Nature communications. 8:15492
- Lim, S.E., Esain, V., Kwan, W., Theodore, L.N., Cortes, M., Frost, I.M., Liu, S.Y., North, T.E. (2017) HIF1α-induced PDGFRβ signaling promotes developmental HSC production via IL-6 activation. Experimental hematology. 46:83-95.e6
- Harris, J.M., Esain, V., Frechette, G.M., Harris, L.J., Cox, A.G., Cortes, M., Garnaas, M.K., Carroll, K.J., Cutting, C.C., Khan, T., Elks, P.M., Renshaw, S.A., Dickinson, B.C., Chang, C.J., Murphy, M.P., Paw, B.H., Vander Heiden, M.G., Goessling, W., and North, T.E. (2013) Glucose metabolism impacts the spatio-temporal onset and magnitude of HSC induction in vivo. Blood. 121(13):2483-2493
- Mendelsohn, B.A., Kassebaum, B.L., and Gitlin, J.D. (2008) The zebrafish embryo as a dynamic model of anoxia tolerance. Developmental Dynamics : an official publication of the American Association of Anatomists. 237(7):1780-1788
1 - 8 of 8
Show