ZFIN ID: ZDB-MRPHLNO-081114-4
Morpholino Name: MO6-cxcr4a
Target: cxcr4a (1)
Previous Name: cxcr4aMO2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CCTTCAGTCTCCAGCAAGTCTTCAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO6-cxcr4a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO6-cxcr4a
Expressed Gene Anatomy Figures
cp Fig. 2 with image from Mizoguchi et al., 2008
ctslb Fig. 4 with image from Mizoguchi et al., 2008
dlx3b Fig. 4 with image from Mizoguchi et al., 2008
foxa3 Fig. 2 with image from Mizoguchi et al., 2008
ins Fig. 2 with image from Mizoguchi et al., 2008
myod1 Fig. 4 with image from Mizoguchi et al., 2008
pdx1 Fig. 2 with image from Mizoguchi et al., 2008
sox17 Fig. 2 with image from Mizoguchi et al., 2008
tbxta Fig. 4 with image from Mizoguchi et al., 2008
PHENOTYPE
Phenotype resulting from MO6-cxcr4a
Phenotype of all Fish created by or utilizing MO6-cxcr4a
Genome Resources:
CITATIONS (1)