Morpholino

MO3-sparc

ID
ZDB-MRPHLNO-081105-2
Name
MO3-sparc
Previous Names
  • E3I3-MO (1)
Target
Sequence
5' - GAAAAATGAACTCACTCTCAGCAAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-sparc
No data available
Phenotype
Phenotype resulting from MO3-sparc
Phenotype Fish Figures
anterior macula position, abnormal AB + MO3-sparc Fig. 7 from Rotllant et al., 2008
anterior semicircular canal aplastic, abnormal AB + MO3-sparc Fig. 7 from Rotllant et al., 2008
blood island gata1a expression decreased amount, abnormal AB + MO3-sparc Fig. 2 from Ceinos et al., 2013
ceratobranchial cartilage aplastic, abnormal AB + MO3-sparc Fig. 4Fig. 8 from Rotllant et al., 2008
ceratohyal cartilage aplastic, abnormal AB + MO3-sparc Fig. 4 from Rotllant et al., 2008
ceratohyal cartilage decreased size, abnormal AB + MO3-sparc Fig. 4Fig. 8 from Rotllant et al., 2008
chondrocranium cartilage decreased size, abnormal AB + MO3-sparc Fig. 4 from Rotllant et al., 2008
cranial cartilage morphology, abnormal AB + MO3-sparc Fig. 4 from Rotllant et al., 2008
erythrocyte differentiation decreased occurrence, abnormal AB + MO3-sparc Fig. 2 from Ceinos et al., 2013
erythroid lineage cell hbbe3 expression decreased amount, abnormal AB + MO3-sparc Fig. 2 from Ceinos et al., 2013
immature posterior macula aplastic, abnormal AB + MO3-sparc Fig. 6Fig. 8 from Rotllant et al., 2008
inner ear decreased size, abnormal AB + MO3-sparc Fig. 7 from Rotllant et al., 2008
inner ear morphogenesis disrupted, abnormal AB + MO3-sparc Fig. 7Fig. 8 from Rotllant et al., 2008
intermediate cell mass of mesoderm gata1a expression decreased amount, abnormal AB + MO3-sparc Fig. 2 from Ceinos et al., 2013
intermediate cell mass of mesoderm cell population proliferation increased occurrence, abnormal AB + MO3-sparc Fig. 5 from Ceinos et al., 2013
lateral crista primordium aplastic, abnormal AB + MO3-sparc Fig. 7Fig. 8 from Rotllant et al., 2008
lateral semicircular canal aplastic, abnormal AB + MO3-sparc Fig. 7 from Rotllant et al., 2008
Meckel's cartilage aplastic, abnormal AB + MO3-sparc Fig. 4Fig. 8 from Rotllant et al., 2008
Meckel's cartilage decreased size, abnormal AB + MO3-sparc Fig. 4 from Rotllant et al., 2008
notochord morphology, abnormal AB + MO3-sparc Fig. 8 from Rotllant et al., 2008
otic vesicle formation disrupted, abnormal AB + MO3-sparc Fig. 6Fig. 8 from Rotllant et al., 2008
pectoral fin decreased size, abnormal AB + MO3-sparc Fig. 4 from Rotllant et al., 2008
pectoral fin kinked, abnormal AB + MO3-sparc Fig. 4 from Rotllant et al., 2008
pectoral fin cartilage morphology, abnormal AB + MO3-sparc Fig. 4 from Rotllant et al., 2008
posterior macula position, abnormal AB + MO3-sparc Fig. 7 from Rotllant et al., 2008
posterior semicircular canal aplastic, abnormal AB + MO3-sparc Fig. 7 from Rotllant et al., 2008
trunk apoptotic process increased occurrence, abnormal AB + MO3-sparc Fig. 5 from Ceinos et al., 2013
ventral mandibular arch decreased size, abnormal AB + MO3-sparc Fig. 4 from Rotllant et al., 2008
vestibuloauditory system functionality, abnormal AB + MO3-sparc Fig. 4 from Rotllant et al., 2008
whole organism curved dorsal, abnormal AB + MO3-sparc Fig. 8 from Rotllant et al., 2008
whole organism gata1a expression decreased amount, abnormal AB + MO3-sparc Fig. 2 from Ceinos et al., 2013
whole organism hbbe3 expression decreased amount, abnormal AB + MO3-sparc Fig. 2 from Ceinos et al., 2013
whole organism decreased length, abnormal AB + MO3-sparc Fig. 4 from Rotllant et al., 2008
whole organism lethal (sensu genetics), abnormal AB + MO3-sparc text only from Rotllant et al., 2008
Phenotype of all Fish created by or utilizing MO3-sparc
Phenotype Fish Conditions Figures
inner ear decreased size, abnormal AB + MO3-sparc standard conditions Fig. 7 from Rotllant et al., 2008
intermediate cell mass of mesoderm cell population proliferation increased occurrence, abnormal AB + MO3-sparc control Fig. 5 from Ceinos et al., 2013
intermediate cell mass of mesoderm gata1a expression decreased amount, abnormal AB + MO3-sparc control Fig. 2 from Ceinos et al., 2013
blood island gata1a expression decreased amount, abnormal AB + MO3-sparc control Fig. 2 from Ceinos et al., 2013
erythroid lineage cell hbbe3 expression decreased amount, abnormal AB + MO3-sparc control Fig. 2 from Ceinos et al., 2013
anterior macula position, abnormal AB + MO3-sparc standard conditions Fig. 7 from Rotllant et al., 2008
inner ear morphogenesis disrupted, abnormal AB + MO3-sparc standard conditions Fig. 7Fig. 8 from Rotllant et al., 2008
posterior semicircular canal aplastic, abnormal AB + MO3-sparc standard conditions Fig. 7 from Rotllant et al., 2008
chondrocranium cartilage decreased size, abnormal AB + MO3-sparc standard conditions Fig. 4 from Rotllant et al., 2008
lateral crista primordium aplastic, abnormal AB + MO3-sparc standard conditions Fig. 7Fig. 8 from Rotllant et al., 2008
pectoral fin decreased size, abnormal AB + MO3-sparc standard conditions Fig. 4 from Rotllant et al., 2008
whole organism hbbe3 expression decreased amount, abnormal AB + MO3-sparc control Fig. 2 from Ceinos et al., 2013
ceratohyal cartilage aplastic, abnormal AB + MO3-sparc standard conditions Fig. 4 from Rotllant et al., 2008
Meckel's cartilage decreased size, abnormal AB + MO3-sparc standard conditions Fig. 4 from Rotllant et al., 2008
whole organism gata1a expression decreased amount, abnormal AB + MO3-sparc control Fig. 2 from Ceinos et al., 2013
whole organism decreased length, abnormal AB + MO3-sparc standard conditions Fig. 4 from Rotllant et al., 2008
otic vesicle formation disrupted, abnormal AB + MO3-sparc standard conditions Fig. 6Fig. 8 from Rotllant et al., 2008
lateral semicircular canal aplastic, abnormal AB + MO3-sparc standard conditions Fig. 7 from Rotllant et al., 2008
immature posterior macula aplastic, abnormal AB + MO3-sparc standard conditions Fig. 6Fig. 8 from Rotllant et al., 2008
ventral mandibular arch decreased size, abnormal AB + MO3-sparc standard conditions Fig. 4 from Rotllant et al., 2008
vestibuloauditory system functionality, abnormal AB + MO3-sparc standard conditions Fig. 4 from Rotllant et al., 2008
whole organism curved dorsal, abnormal AB + MO3-sparc standard conditions Fig. 8 from Rotllant et al., 2008
notochord morphology, abnormal AB + MO3-sparc standard conditions Fig. 8 from Rotllant et al., 2008
pectoral fin kinked, abnormal AB + MO3-sparc standard conditions Fig. 4 from Rotllant et al., 2008
erythrocyte differentiation decreased occurrence, abnormal AB + MO3-sparc control Fig. 2 from Ceinos et al., 2013
posterior macula position, abnormal AB + MO3-sparc standard conditions Fig. 7 from Rotllant et al., 2008
pectoral fin cartilage morphology, abnormal AB + MO3-sparc standard conditions Fig. 4 from Rotllant et al., 2008
anterior semicircular canal aplastic, abnormal AB + MO3-sparc standard conditions Fig. 7 from Rotllant et al., 2008
trunk apoptotic process increased occurrence, abnormal AB + MO3-sparc control Fig. 5 from Ceinos et al., 2013
cranial cartilage morphology, abnormal AB + MO3-sparc standard conditions Fig. 4 from Rotllant et al., 2008
ceratobranchial cartilage aplastic, abnormal AB + MO3-sparc standard conditions Fig. 4Fig. 8 from Rotllant et al., 2008
whole organism lethal (sensu genetics), abnormal AB + MO3-sparc standard conditions text only from Rotllant et al., 2008
Meckel's cartilage aplastic, abnormal AB + MO3-sparc standard conditions Fig. 4Fig. 8 from Rotllant et al., 2008
ceratohyal cartilage decreased size, abnormal AB + MO3-sparc standard conditions Fig. 4Fig. 8 from Rotllant et al., 2008
Citations