Morpholino
MO3-sparc
- ID
- ZDB-MRPHLNO-081105-2
- Name
- MO3-sparc
- Previous Names
-
- E3I3-MO (1)
- Target
- Sequence
-
5' - GAAAAATGAACTCACTCTCAGCAAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-sparc
Expressed Gene | Anatomy | Figures |
---|---|---|
atp1a1a.4 | (all 4) |
Fig. 7,
Fig. 8
from Rotllant et al., 2008 |
cldna |
Fig. 6
from Rotllant et al., 2008 |
|
col2a1a | (all 4) |
Fig. 4,
Fig. 8
from Rotllant et al., 2008 |
dlx2a | (all 5) |
Fig. 4
from Rotllant et al., 2008 |
dlx3b |
Fig. 6
from Rotllant et al., 2008 |
1 - 5 of 19 Show all
Phenotype
Phenotype resulting from MO3-sparc
1 - 5 of 34 Show all
Phenotype of all Fish created by or utilizing MO3-sparc
1 - 5 of 34 Show all
Citations
- Ceinos, R.M., Torres-Nuñez, E., Chamorro, R., Novoa, B., Figueras, A., Ruane, N.M., and Rotllant, J. (2013) Critical Role of the Matricellular Protein SPARC in Mediating Erythroid Progenitor Cell Development in Zebrafish. Cells, tissues, organs. 197(3):196-208
- Rotllant, J., Liu, D., Yan, Y.L., Postlethwait, J.H., Westerfield, M., and Du, S.J. (2008) Sparc (Osteonectin) functions in morphogenesis of the pharyngeal skeleton and inner ear. Matrix biology : journal of the International Society for Matrix Biology. 27(6):561-572
1 - 2 of 2
Show