Morpholino

MO2-sparc

ID
ZDB-MRPHLNO-081105-1
Name
MO2-sparc
Previous Names
  • ATG-MO (1)
Target
Sequence
5' - GATCCAAACCCTCATCTTGAGTTTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-sparc
Expressed Gene Anatomy Figures
gata1a Fig. 6 from Ceinos et al., 2013
Phenotype
Phenotype resulting from MO2-sparc
Phenotype Fish Figures
ceratobranchial cartilage aplastic, abnormal AB + MO2-sparc text only from Rotllant et al., 2008
ceratohyal cartilage decreased size, abnormal AB + MO2-sparc text only from Rotllant et al., 2008
chondrocranium cartilage decreased size, abnormal AB + MO2-sparc text only from Rotllant et al., 2008
intermediate cell mass of mesoderm gata1a expression decreased amount, abnormal AB + MO2-sparc Fig. 6 from Ceinos et al., 2013
Meckel's cartilage decreased size, abnormal AB + MO2-sparc text only from Rotllant et al., 2008
pectoral fin decreased size, abnormal AB + MO2-sparc text only from Rotllant et al., 2008
pectoral fin kinked, abnormal AB + MO2-sparc text only from Rotllant et al., 2008
ventral mandibular arch decreased size, abnormal AB + MO2-sparc text only from Rotllant et al., 2008
vestibuloauditory system functionality, abnormal AB + MO2-sparc text only from Rotllant et al., 2008
whole organism decreased length, abnormal AB + MO2-sparc text only from Rotllant et al., 2008
whole organism lethal (sensu genetics), abnormal AB + MO2-sparc text only from Rotllant et al., 2008
Phenotype of all Fish created by or utilizing MO2-sparc
Phenotype Fish Conditions Figures
intermediate cell mass of mesoderm gata1a expression decreased amount, abnormal AB + MO2-sparc control Fig. 6 from Ceinos et al., 2013
chondrocranium cartilage decreased size, abnormal AB + MO2-sparc standard conditions text only from Rotllant et al., 2008
vestibuloauditory system functionality, abnormal AB + MO2-sparc standard conditions text only from Rotllant et al., 2008
pectoral fin kinked, abnormal AB + MO2-sparc standard conditions text only from Rotllant et al., 2008
whole organism lethal (sensu genetics), abnormal AB + MO2-sparc standard conditions text only from Rotllant et al., 2008
Meckel's cartilage decreased size, abnormal AB + MO2-sparc standard conditions text only from Rotllant et al., 2008
whole organism decreased length, abnormal AB + MO2-sparc standard conditions text only from Rotllant et al., 2008
pectoral fin decreased size, abnormal AB + MO2-sparc standard conditions text only from Rotllant et al., 2008
ceratobranchial cartilage aplastic, abnormal AB + MO2-sparc standard conditions text only from Rotllant et al., 2008
ceratohyal cartilage decreased size, abnormal AB + MO2-sparc standard conditions text only from Rotllant et al., 2008
ventral mandibular arch decreased size, abnormal AB + MO2-sparc standard conditions text only from Rotllant et al., 2008
intermediate cell mass of mesoderm gata1a expression decreased amount, abnormal AB + MO2-sparc + MO4-tp53 control Fig. 6 from Ceinos et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.