Morpholino
MO7-sox18
- ID
- ZDB-MRPHLNO-081022-6
- Name
- MO7-sox18
- Previous Names
-
- sox18-MO2 (1)
- Target
- Sequence
-
5' - GTGAGTGTCTTACCCAGCATTTTAC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
binds to intron splice site
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO7-sox18
No data available
Phenotype
Phenotype resulting from MO7-sox18
1 - 5 of 10 Show all
Phenotype of all Fish created by or utilizing MO7-sox18
1 - 5 of 17 Show all
Citations
- Moleri, S., Mercurio, S., Pezzotta, A., D'Angelo, D., Brix, A., Plebani, A., Lini, G., Di Fuorti, M., Beltrame, M. (2023) Lymphatic Defects in Zebrafish sox18 Mutants Are Exacerbated by Perturbed VEGFC Signaling, While Masked by Elevated sox7 Expression. Cells. 12(18):
- Cermenati, S., Moleri, S., Neyt, C., Bresciani, E., Carra, S., Grassini, D.R., Omini, A., Goi, M., Cotelli, F., François, M., Hogan, B.M., and Beltrame, M. (2013) Sox18 Genetically Interacts With VegfC to Regulate Lymphangiogenesis in Zebrafish. Arterioscler. Thromb. Vasc. Biol.. 33(6):1238-47
- Cermenati, S., Moleri, S., Cimbro, S., Corti, P., Del Giacco, L., Amodeo, R., Dejana, E., Koopman, P., Cotelli, F., and Beltrame, M. (2008) Sox18 and Sox7 play redundant roles in vascular development. Blood. 111(5):2657-2666
1 - 3 of 3
Show