header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-081020-4
Morpholino Name: MO4-ret
Target: ret (1)
Previous Names: MO4-ret1, ret51Sp (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TGACATGCCTAAAAACGAGAACATA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice blocking morpholino that specifically targets the exon 19-intron 19 boundary; the "Ret51" isoform of ret1 is not produced.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-ret No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-ret
Expressed Gene Anatomy Figures
ret Fig. 3 with image from Heanue et al., 2008
PHENOTYPE
Phenotype resulting from MO4-ret
No data available

Phenotype of all Fish created by or utilizing MO4-ret
No data available
OTHER MO4-ret MORPHOLINO PAGESNo links to external sites
CITATIONS (1)