Morpholino

MO2-itga7

ID
ZDB-MRPHLNO-080930-2
Name
MO2-itga7
Previous Names
  • integrin a7-splice MO (1)
Target
Sequence
5' - CTCAGATCAGTGCAGACTCACCAGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genome Build: GRCz11Chromosome: 11
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-itga7
Phenotype
Phenotype resulting from MO2-itga7
Phenotype of all Fish created by or utilizing MO2-itga7
Phenotype Fish Conditions Figures
whole organism paralysed, abnormal WT + MO2-itga7 standard conditions Fig. 3 with image from Postel et al., 2008
locomotion involved in locomotory behavior decreased rate, abnormal WT + MO2-itga7 standard conditions Fig. 8 with image from Goody et al., 2012
skeletal muscle cell actin cytoskeleton retracted, abnormal WT + MO2-itga7 standard conditions Fig. 3 with image from Postel et al., 2008
myotome muscle cell detached from myotome muscle tendon junction, abnormal WT + MO2-itga7 standard conditions Fig. 3 with imageFig. 7 with image from Goody et al., 2012
locomotion involved in locomotory behavior decreased rate, abnormal WT + MO2-itga7 chemical treatment: NAD(+) Fig. 8 with image from Goody et al., 2012
myotome muscle cell degenerate, abnormal WT + MO1-dag1 + MO2-itga7 chemical treatment: NAD(+) Fig. 3 with image from Goody et al., 2012
myotome muscle cell degenerate, abnormal WT + MO1-dag1 + MO2-itga7 standard conditions Fig. 3 with image from Goody et al., 2012
myotome muscle tendon junction malformed, abnormal WT + MO1-dag1 + MO2-itga7 chemical treatment: NAD(+) Fig. 3 with image from Goody et al., 2012
vertical myoseptum malformed, abnormal WT + MO1-dag1 + MO2-itga7 standard conditions Fig. 3 with image from Goody et al., 2012
myotome muscle cell detached from myotome muscle tendon junction, abnormal WT + MO1-dag1 + MO2-itga7 standard conditions Fig. 3 with image from Goody et al., 2012
vertical myoseptum malformed, abnormal WT + MO1-dag1 + MO2-itga7 chemical treatment: NAD(+) Fig. 3 with image from Goody et al., 2012
myotome muscle tendon junction malformed, abnormal WT + MO1-dag1 + MO2-itga7 standard conditions Fig. 3 with image from Goody et al., 2012
myotome muscle cell detached from myotome muscle tendon junction, abnormal WT + MO1-dag1 + MO2-itga7 chemical treatment: NAD(+) Fig. 3 with image from Goody et al., 2012
myotome muscle cell detached from myotome muscle tendon junction, abnormal mai1Tg + MO2-itga7 standard conditions Fig. 7 with image from Goody et al., 2012
locomotion involved in locomotory behavior decreased rate, abnormal mai1Tg + MO2-itga7 standard conditions Fig. 8 with image from Goody et al., 2012
skeletal muscle cell sarcolemma retracted, abnormal vu119Tg + MO2-itga7 standard conditions Fig. S5 with image from Postel et al., 2008
skeletal muscle cell actin cytoskeleton retracted, abnormal vu119Tg + MO2-itga7 standard conditions Fig. S5 with image from Postel et al., 2008
Citations