ZFIN ID: ZDB-MRPHLNO-080925-5
Morpholino Name: MO3-pax6b
Target: pax6b (1)
Sequence:
5' - TGGTATTCTTTTTGAGGCATTCTGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-pax6b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-pax6b
Expressed Gene Anatomy Figures
pax6a Fig. 3 with image from Kleinjan et al., 2008
PHENOTYPE
Phenotype resulting from MO3-pax6b
Phenotype of all Fish created by or utilizing MO3-pax6b
Genome Resources:
CITATIONS (2)