Morpholino

MO2-loxa

ID
ZDB-MRPHLNO-080921-2
Name
MO2-loxa
Previous Names
None
Target
Sequence
5' - GTTCTTCTACTTGCCGACGTTCCAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-loxa
Expressed Gene Anatomy Figures
col2a1a Fig. 5 from Reynaud et al., 2008
dlx2a Fig. 7,  Fig. 8 from Reynaud et al., 2008
egr2b Fig. 8 from Reynaud et al., 2008
loxa Fig. 3 from Reynaud et al., 2008
myod1 Fig. 6 from Reynaud et al., 2008
shha Fig. 5,  Fig. 7 from Reynaud et al., 2008
Phenotype
Phenotype resulting from MO2-loxa
Phenotype Fish Figures
brain structure, abnormal WT + MO2-loxa Fig. 3 from Reynaud et al., 2008
eye colorless, abnormal WT + MO2-loxa Fig. 3 from Reynaud et al., 2008
eye decreased size, abnormal WT + MO2-loxa Fig. 3 from Reynaud et al., 2008
forebrain development disrupted, abnormal WT + MO2-loxa Fig. 7 from Reynaud et al., 2008
hindbrain development disrupted, abnormal WT + MO2-loxa Fig. 8 from Reynaud et al., 2008
muscle cell myofibril decreased amount, abnormal WT + MO2-loxa Fig. 6 from Reynaud et al., 2008
muscle cell myofibril disorganized, abnormal WT + MO2-loxa Fig. 6 from Reynaud et al., 2008
muscle cell migration disrupted, abnormal WT + MO2-loxa Fig. 6 from Reynaud et al., 2008
muscle organ development disrupted, abnormal WT + MO2-loxa Fig. 6 from Reynaud et al., 2008
notochord morphology, abnormal WT + MO2-loxa Fig. 5 from Reynaud et al., 2008
notochord undulate, abnormal WT + MO2-loxa Fig. 3 from Reynaud et al., 2008
pericardium edematous, abnormal WT + MO2-loxa Fig. 3 from Reynaud et al., 2008
pharyngeal arch cartilage deformed, abnormal WT + MO2-loxa Fig. 8 from Reynaud et al., 2008
pharyngeal system development disrupted, abnormal WT + MO2-loxa Fig. 8 from Reynaud et al., 2008
pigment cell spatial pattern, abnormal WT + MO2-loxa Fig. 3 from Reynaud et al., 2008
pigmentation disrupted, abnormal WT + MO2-loxa Fig. 3 from Reynaud et al., 2008
post-vent region curvature, abnormal WT + MO2-loxa Fig. 3 from Reynaud et al., 2008
primary motor neuron axon decreased length, abnormal WT + MO2-loxa Fig. 7 from Reynaud et al., 2008
primary motor neuron neuron projection decreased amount, abnormal WT + MO2-loxa Fig. 7 from Reynaud et al., 2008
somite condensed, abnormal WT + MO2-loxa Fig. 3 from Reynaud et al., 2008
somite shape, abnormal WT + MO2-loxa Fig. 6 from Reynaud et al., 2008
spinal cord neuron decreased amount, abnormal WT + MO2-loxa Fig. 7 from Reynaud et al., 2008
spinal cord neuron disorganized, abnormal WT + MO2-loxa Fig. 7 from Reynaud et al., 2008
whole organism decreased length, abnormal WT + MO2-loxa Fig. 3,  Fig. 4 from Reynaud et al., 2008
whole organism lethal (sensu genetics), abnormal WT + MO2-loxa Fig. 3 from Reynaud et al., 2008
whole organism morphology, abnormal WT + MO2-loxa + MO5-tp53 Fig. 4 from Reynaud et al., 2008
Phenotype of all Fish created by or utilizing MO2-loxa
Phenotype Fish Conditions Figures
whole organism lethal (sensu genetics), abnormal WT + MO2-loxa standard conditions Fig. 3 from Reynaud et al., 2008
forebrain development disrupted, abnormal WT + MO2-loxa standard conditions Fig. 7 from Reynaud et al., 2008
pigment cell spatial pattern, abnormal WT + MO2-loxa standard conditions Fig. 3 from Reynaud et al., 2008
pharyngeal system development disrupted, abnormal WT + MO2-loxa standard conditions Fig. 8 from Reynaud et al., 2008
spinal cord neuron decreased amount, abnormal WT + MO2-loxa standard conditions Fig. 7 from Reynaud et al., 2008
pericardium edematous, abnormal WT + MO2-loxa standard conditions Fig. 3 from Reynaud et al., 2008
somite shape, abnormal WT + MO2-loxa standard conditions Fig. 6 from Reynaud et al., 2008
pharyngeal arch cartilage deformed, abnormal WT + MO2-loxa standard conditions Fig. 8 from Reynaud et al., 2008
notochord undulate, abnormal WT + MO2-loxa standard conditions Fig. 3 from Reynaud et al., 2008
brain structure, abnormal WT + MO2-loxa standard conditions Fig. 3 from Reynaud et al., 2008
post-vent region curvature, abnormal WT + MO2-loxa standard conditions Fig. 3 from Reynaud et al., 2008
somite condensed, abnormal WT + MO2-loxa standard conditions Fig. 3 from Reynaud et al., 2008
spinal cord neuron disorganized, abnormal WT + MO2-loxa standard conditions Fig. 7 from Reynaud et al., 2008
muscle cell myofibril decreased amount, abnormal WT + MO2-loxa standard conditions Fig. 6 from Reynaud et al., 2008
primary motor neuron neuron projection decreased amount, abnormal WT + MO2-loxa standard conditions Fig. 7 from Reynaud et al., 2008
eye decreased size, abnormal WT + MO2-loxa standard conditions Fig. 3 from Reynaud et al., 2008
whole organism morphology, abnormal WT + MO2-loxa standard conditions Fig. 4 from Reynaud et al., 2008
muscle cell myofibril disorganized, abnormal WT + MO2-loxa standard conditions Fig. 6 from Reynaud et al., 2008
primary motor neuron axon decreased length, abnormal WT + MO2-loxa standard conditions Fig. 7 from Reynaud et al., 2008
muscle organ development disrupted, abnormal WT + MO2-loxa standard conditions Fig. 6 from Reynaud et al., 2008
hindbrain development disrupted, abnormal WT + MO2-loxa standard conditions Fig. 8 from Reynaud et al., 2008
pigmentation disrupted, abnormal WT + MO2-loxa standard conditions Fig. 3 from Reynaud et al., 2008
notochord morphology, abnormal WT + MO2-loxa standard conditions Fig. 5 from Reynaud et al., 2008
eye colorless, abnormal WT + MO2-loxa standard conditions Fig. 3 from Reynaud et al., 2008
whole organism decreased length, abnormal WT + MO2-loxa standard conditions Fig. 3,  Fig. 4 from Reynaud et al., 2008
muscle cell migration disrupted, abnormal WT + MO2-loxa standard conditions Fig. 6 from Reynaud et al., 2008
whole organism decreased length, abnormal WT + MO2-loxa + MO5-tp53 standard conditions Fig. 4 from Reynaud et al., 2008
whole organism morphology, abnormal WT + MO2-loxa + MO5-tp53 standard conditions Fig. 4 from Reynaud et al., 2008
notochord undulate, abnormal WT + MO1-loxl1 + MO1-loxl5b + MO2-loxa control Fig. 2 from van Boxtel et al., 2010
notochord morphology, exacerbated WT + MO1-loxl1 + MO1-loxl5b + MO2-loxa chemical treatment by environment: thiram Fig. 3 from van Boxtel et al., 2010
notochord morphology, exacerbated WT + MO1-loxl1 + MO1-loxl5b + MO2-loxa chemical treatment by environment: disulfiram Fig. 3 from van Boxtel et al., 2010
notochord morphology, abnormal WT + MO1-loxl1 + MO1-loxl5b + MO2-loxa control Fig. 2 from van Boxtel et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.