Morpholino
MO1-foxg1a
- ID
- ZDB-MRPHLNO-080911-1
- Name
- MO1-foxg1a
- Previous Names
-
- MO1-foxg1
- Target
- Sequence
-
5' - TCCCATATCCAACATCACAAGTAAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-foxg1a
Expressed Gene | Anatomy | Figures |
---|---|---|
calb2b |
Fig. 6,
Fig. S5
from Duggan et al., 2008 |
|
cxcr4b |
Fig. 6
from Duggan et al., 2008 |
|
fgf8a |
Fig. S5
from Duggan et al., 2008 |
|
ompb |
Fig. 6
from Duggan et al., 2008 |
1 - 4 of 4
Phenotype
Phenotype resulting from MO1-foxg1a
1 - 5 of 8 Show all
Phenotype of all Fish created by or utilizing MO1-foxg1a
1 - 5 of 8 Show all
Citations
- Picker, A., Cavodeassi, F., Machate, A., Bernauer, S., Hans, S., Abe, G., Kawakami, K., Wilson, S.W., and Brand, M. (2009) Dynamic coupling of pattern formation and morphogenesis in the developing vertebrate retina. PLoS Biology. 7(10):e1000214
- Duggan, C.D., Demaria, S., Baudhuin, A., Stafford, D., and Ngai, J. (2008) Foxg1 is required for development of the vertebrate olfactory system. The Journal of neuroscience : the official journal of the Society for Neuroscience. 28(20):5229-5239
1 - 2 of 2
Show