Morpholino

MO3-cdh6

ID
ZDB-MRPHLNO-080910-1
Name
MO3-cdh6
Previous Names
  • cdh6MO2 (1)
Target
Sequence
5' - TCCGCTCTTAGGGTGTCTTACAGGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-cdh6
Expressed Gene Anatomy Figures
atoh7 Fig. 6 from Liu et al., 2008
dlc Fig. 6 from Liu et al., 2008
neurod1 Fig. 4 with image from Liu et al., 2011
Fig. 6 from Liu et al., 2008
notch1a Fig. 6 from Liu et al., 2008
otx5 Fig. 6 from Liu et al., 2008
Phenotype
Phenotype resulting from MO3-cdh6
Phenotype Fish Figures
cell differentiation disrupted, abnormal WT + MO3-cdh6 Fig. 8,  Fig. 9 from Liu et al., 2008
cell population proliferation disrupted, abnormal WT + MO3-cdh6 Fig. 5 from Liu et al., 2008
cranial ganglion neurod1 expression decreased distribution, abnormal WT + MO3-cdh6 Fig. 4 with image from Liu et al., 2011
cranial nerve II morphology, abnormal WT + MO3-cdh6 Fig. 8 from Liu et al., 2008
cranial nerve V morphology, abnormal WT + MO3-cdh6 Fig. 7 with image from Liu et al., 2011
cranial nerve X decreased branchiness, abnormal WT + MO3-cdh6 Fig. 7 with image from Liu et al., 2011
cranial nerve X defasciculated, abnormal WT + MO3-cdh6 Fig. 7 with image from Liu et al., 2011
dorsal anterior lateral line ganglion decreased size, abnormal WT + MO3-cdh6 Fig. 3 with image from Liu et al., 2011
dorsal anterior lateral line ganglion elongated, abnormal WT + MO3-cdh6 Fig. 3 with image from Liu et al., 2011
dorsal anterior lateral line nerve morphology, abnormal WT + MO3-cdh6 Fig. 7 with image from Liu et al., 2011
extension decreased length, abnormal WT + MO3-cdh6 Fig. 2 with image from Liu et al., 2011
Fig. 3 from Liu et al., 2008
eye decreased size, abnormal WT + MO3-cdh6 Fig. 2 with image from Liu et al., 2011
Fig. 3,  Fig. 6,  Fig. 7 from Liu et al., 2008
eye photoreceptor cell decreased amount, abnormal WT + MO3-cdh6 Fig. 11 from Liu et al., 2008
head decreased size, abnormal WT + MO3-cdh6 Fig. 2 with image from Liu et al., 2011
Fig. 3 from Liu et al., 2008
pericardium edematous, abnormal WT + MO3-cdh6 Fig. 2 with image from Liu et al., 2011
Fig. 3 from Liu et al., 2008
posterior lateral line ganglion increased size, abnormal WT + MO3-cdh6 Fig. 3 with image from Liu et al., 2011
posterior lateral line nerve decreased thickness, abnormal WT + MO3-cdh6 Fig. 7 with image from Liu et al., 2011
retina morphology, abnormal WT + MO3-cdh6 Fig. 5 from Liu et al., 2008
retina structure, abnormal WT + MO3-cdh6 Fig. 7 from Liu et al., 2008
retina layer formation delayed, abnormal WT + MO3-cdh6 Fig. 7 from Liu et al., 2008
retina morphogenesis in camera-type eye disrupted, abnormal WT + MO3-cdh6 Fig. 8,  Fig. 9 from Liu et al., 2008
retinal ganglion cell layer morphology, abnormal WT + MO3-cdh6 Fig. 8,  Fig. 9 from Liu et al., 2008
retinal inner nuclear layer morphology, abnormal WT + MO3-cdh6 Fig. 9 from Liu et al., 2008
retinal outer nuclear layer morphology, abnormal WT + MO3-cdh6 Fig. 11 from Liu et al., 2008
statoacoustic (VIII) ganglion zn-5 labeling decreased distribution, abnormal WT + MO3-cdh6 Fig. 5 with image from Liu et al., 2011
statoacoustic (VIII) ganglion decreased size, abnormal WT + MO3-cdh6 Fig. 3 with image from Liu et al., 2011
trigeminal ganglion fragmented, abnormal WT + MO3-cdh6 Fig. 3 with image from Liu et al., 2011
trigeminal ganglion irregularly shaped, abnormal WT + MO3-cdh6 Fig. 3 with image from Liu et al., 2011
vagal ganglion zn-5 labeling decreased amount, abnormal WT + MO3-cdh6 Fig. 5 with image from Liu et al., 2011
vagal ganglion decreased size, abnormal WT + MO3-cdh6 Fig. 3 with image from Liu et al., 2011
vagal root decreased thickness, abnormal WT + MO3-cdh6 Fig. 7 with image from Liu et al., 2011
ventral anterior lateral line nerve morphology, abnormal WT + MO3-cdh6 Fig. 7 with image from Liu et al., 2011
whole organism curved, abnormal WT + MO3-cdh6 Fig. 3 from Liu et al., 2008
whole organism increased curvature, abnormal WT + MO3-cdh6 Fig. 2 with image from Liu et al., 2011
yolk increased size, abnormal WT + MO3-cdh6 Fig. 2 with image from Liu et al., 2011
Phenotype of all Fish created by or utilizing MO3-cdh6
Phenotype Fish Conditions Figures
retina layer formation delayed, abnormal WT + MO3-cdh6 standard conditions Fig. 7 from Liu et al., 2008
vagal root decreased thickness, abnormal WT + MO3-cdh6 standard conditions Fig. 7 with image from Liu et al., 2011
whole organism increased curvature, abnormal WT + MO3-cdh6 standard conditions Fig. 2 with image from Liu et al., 2011
trigeminal ganglion irregularly shaped, abnormal WT + MO3-cdh6 standard conditions Fig. 3 with image from Liu et al., 2011
posterior lateral line nerve decreased thickness, abnormal WT + MO3-cdh6 standard conditions Fig. 7 with image from Liu et al., 2011
head decreased size, abnormal WT + MO3-cdh6 standard conditions Fig. 2 with image from Liu et al., 2011
Fig. 3 from Liu et al., 2008
retina structure, abnormal WT + MO3-cdh6 standard conditions Fig. 7 from Liu et al., 2008
retinal inner nuclear layer morphology, abnormal WT + MO3-cdh6 standard conditions Fig. 9 from Liu et al., 2008
cranial nerve V morphology, abnormal WT + MO3-cdh6 standard conditions Fig. 7 with image from Liu et al., 2011
retinal outer nuclear layer morphology, abnormal WT + MO3-cdh6 standard conditions Fig. 11 from Liu et al., 2008
cranial nerve X defasciculated, abnormal WT + MO3-cdh6 standard conditions Fig. 7 with image from Liu et al., 2011
dorsal anterior lateral line ganglion elongated, abnormal WT + MO3-cdh6 standard conditions Fig. 3 with image from Liu et al., 2011
cell population proliferation disrupted, abnormal WT + MO3-cdh6 standard conditions Fig. 5 from Liu et al., 2008
ventral anterior lateral line nerve morphology, abnormal WT + MO3-cdh6 standard conditions Fig. 7 with image from Liu et al., 2011
cell differentiation disrupted, abnormal WT + MO3-cdh6 standard conditions Fig. 8,  Fig. 9 from Liu et al., 2008
whole organism curved, abnormal WT + MO3-cdh6 standard conditions Fig. 3 from Liu et al., 2008
pericardium edematous, abnormal WT + MO3-cdh6 standard conditions Fig. 2 with image from Liu et al., 2011
Fig. 3 from Liu et al., 2008
cranial nerve X decreased branchiness, abnormal WT + MO3-cdh6 standard conditions Fig. 7 with image from Liu et al., 2011
dorsal anterior lateral line ganglion decreased size, abnormal WT + MO3-cdh6 standard conditions Fig. 3 with image from Liu et al., 2011
trigeminal ganglion fragmented, abnormal WT + MO3-cdh6 standard conditions Fig. 3 with image from Liu et al., 2011
extension decreased length, abnormal WT + MO3-cdh6 standard conditions Fig. 2 with image from Liu et al., 2011
Fig. 3 from Liu et al., 2008
vagal ganglion decreased size, abnormal WT + MO3-cdh6 standard conditions Fig. 3 with image from Liu et al., 2011
statoacoustic (VIII) ganglion zn-5 labeling decreased distribution, abnormal WT + MO3-cdh6 standard conditions Fig. 5 with image from Liu et al., 2011
retina morphogenesis in camera-type eye disrupted, abnormal WT + MO3-cdh6 standard conditions Fig. 8,  Fig. 9 from Liu et al., 2008
dorsal anterior lateral line nerve morphology, abnormal WT + MO3-cdh6 standard conditions Fig. 7 with image from Liu et al., 2011
yolk increased size, abnormal WT + MO3-cdh6 standard conditions Fig. 2 with image from Liu et al., 2011
vagal ganglion zn-5 labeling decreased amount, abnormal WT + MO3-cdh6 standard conditions Fig. 5 with image from Liu et al., 2011
statoacoustic (VIII) ganglion decreased size, abnormal WT + MO3-cdh6 standard conditions Fig. 3 with image from Liu et al., 2011
cranial ganglion neurod1 expression decreased distribution, abnormal WT + MO3-cdh6 standard conditions Fig. 4 with image from Liu et al., 2011
eye decreased size, abnormal WT + MO3-cdh6 standard conditions Fig. 2 with image from Liu et al., 2011
Fig. 3,  Fig. 6,  Fig. 7 from Liu et al., 2008
eye photoreceptor cell decreased amount, abnormal WT + MO3-cdh6 standard conditions Fig. 11 from Liu et al., 2008
retinal ganglion cell layer morphology, abnormal WT + MO3-cdh6 standard conditions Fig. 8,  Fig. 9 from Liu et al., 2008
cranial nerve II morphology, abnormal WT + MO3-cdh6 standard conditions Fig. 8 from Liu et al., 2008
retina morphology, abnormal WT + MO3-cdh6 standard conditions Fig. 5 from Liu et al., 2008
posterior lateral line ganglion increased size, abnormal WT + MO3-cdh6 standard conditions Fig. 3 with image from Liu et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.