Morpholino

MO1-lgsn

ID

ZDB-MRPHLNO-080818-2

Name

MO1-lgsn

Previous Names

Target

Sequence

5' - GGATTCCTCTGATTCTTGCATGATG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-lgsn

Expressed Gene	Anatomy	Figures
lgsn	(not) lens	Fig. S3 from Harding et al., 2008

Phenotype

Phenotype resulting from MO1-lgsn

Phenotype	Fish	Figures
cell differentiation disrupted, abnormal	WT + MO1-lgsn	Fig. 7, Fig. 8 from Harding et al., 2008
eye decreased size, abnormal	WT + MO1-lgsn	Fig. S4 from Harding et al., 2008
lens decreased size, abnormal	WT + MO1-lgsn	Fig. 7, Fig. S3 from Harding et al., 2008
lens morphology, abnormal	WT + MO1-lgsn	Fig. 7, Fig. 8, Fig. S3 from Harding et al., 2008
lens cell decreased length, abnormal	WT + MO1-lgsn	Fig. 8 from Harding et al., 2008
lens cell morphology, abnormal	WT + MO1-lgsn	Fig. 8 from Harding et al., 2008
lens cell vacuolated, abnormal	WT + MO1-lgsn	Fig. 8 from Harding et al., 2008
lens morphogenesis in camera-type eye disrupted, abnormal	WT + MO1-lgsn	Fig. 7, Fig. 8, Fig. S3 from Harding et al., 2008
retina decreased size, abnormal	WT + MO1-lgsn	Fig. 7 from Harding et al., 2008

Phenotype of all Fish created by or utilizing MO1-lgsn

Phenotype	Fish	Conditions	Figures
lens morphology, abnormal	WT + MO1-lgsn	standard conditions	Fig. 7, Fig. 8, Fig. S3 from Harding et al., 2008
lens decreased size, abnormal	WT + MO1-lgsn	standard conditions	Fig. 7, Fig. S3 from Harding et al., 2008
cell differentiation disrupted, abnormal	WT + MO1-lgsn	standard conditions	Fig. 7, Fig. 8 from Harding et al., 2008
lens cell morphology, abnormal	WT + MO1-lgsn	standard conditions	Fig. 8 from Harding et al., 2008
lens morphogenesis in camera-type eye disrupted, abnormal	WT + MO1-lgsn	standard conditions	Fig. 7, Fig. 8, Fig. S3 from Harding et al., 2008
lens cell decreased length, abnormal	WT + MO1-lgsn	standard conditions	Fig. 8 from Harding et al., 2008
lens cell vacuolated, abnormal	WT + MO1-lgsn	standard conditions	Fig. 8 from Harding et al., 2008
retina decreased size, abnormal	WT + MO1-lgsn	standard conditions	Fig. 7 from Harding et al., 2008
eye decreased size, abnormal	WT + MO1-lgsn	standard conditions	Fig. S4 from Harding et al., 2008

Citations