Morpholino
MO3-sox32
- ID
- ZDB-MRPHLNO-080814-2
- Name
- MO3-sox32
- Previous Names
-
- sox32 MORPH 0008 (1)
- Target
- Sequence
-
5' - CGGTCGAGATACATGCTGTTTTGCG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-sox32
Expressed Gene | Anatomy | Figures |
---|---|---|
cxcl12b |
Fig. 4 ![]() |
|
kdrl |
Fig. 4 ![]() |
1 - 2 of 2
Phenotype
Phenotype resulting from MO3-sox32
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO3-sox32
1 - 5 of 9 Show all
Citations
- Nakajima, H., Ishikawa, H., Yamamoto, T., Chiba, A., Fukui, H., Sako, K., Fukumoto, M., Mattonet, K., Kwon, H.B., Hui, S.P., Dobreva, G.D., Kikuchi, K., Helker, C.S.M., Stainier, D.Y.R., Mochizuki, N. (2023) Endoderm-derived islet1-expressing cells differentiate into endothelial cells to function as the vascular HSPC niche in zebrafish. Developmental Cell. 58(3):224-238.e7
- Nicenboim, J., Malkinson, G., Lupo, T., Asaf, L., Sela, Y., Mayseless, O., Gibbs-Bar, L., Senderovich, N., Hashimshony, T., Shin, M., Jerafi-Vider, A., Avraham-Davidi, I., Krupalnik, V., Hofi, R., Almog, G., Astin, J.W., Golani, O., Ben-Dor, S., Crosier, P.S., Herzog, W., Lawson, N.D., Hanna, J.H., Yanai, I., Yaniv, K. (2015) Lymphatic vessels arise from specialized angioblasts within a venous niche. Nature. 522(7554):56-61
- Helker, C.S., Schuermann, A., Karpanen, T., Zeuschner, D., Belting, H.G., Affolter, M., Schulte-Merker, S., and Herzog, W. (2013) The zebrafish common cardinal veins develop by a novel mechanism: lumen ensheathment. Development (Cambridge, England). 140(13):2776-2786
- Stückemann, T., Wegleiter, T., Stefan, E., Nägele, O., Tarbashevich, K., Böck, G., Raz, E., and Aanstad, P. (2012) Zebrafish Cxcr4a determines the proliferative response to Hedgehog signalling. Development (Cambridge, England). 139(15):2711-2720
- Chan, T.M., Chao, C.H., Wang, H.D., Yu, Y.J., and Yuh, C.H. (2009) Functional analysis of the evolutionarily conserved Cis-regulatory elements on the Sox17 gene in zebrafish. Developmental Biology. 326(2):456-470
- Siekmann, A.F., Standley, C., Fogarty, K.E., Wolfe, S.A., and Lawson, N.D. (2009) Chemokine signaling guides regional patterning of the first embryonic artery. Genes & Development. 23(19):2272-2277
- Chung, W.S., and Stainier, D.Y. (2008) Intra-endodermal interactions are required for pancreatic beta cell induction. Developmental Cell. 14(4):582-593
- Griffin, K.J.P. and Kimelman, D. (2002) One-Eyed Pinhead and Spadetail are essential for heart and somite formation. Nature cell biology. 4(10):821-825
1 - 8 of 8
Show