Morpholino
MO1-cdkn1a
- ID
- ZDB-MRPHLNO-080808-5
- Name
- MO1-cdkn1a
- Previous Names
-
- p21MO (1)
- Target
- Sequence
-
5' - TAATAAAGAGGTCTGACCTGTGATG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Targets a splice donor site.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cdkn1a
No data available
Phenotype
Phenotype resulting from MO1-cdkn1a
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO1-cdkn1a
1 - 5 of 7 Show all
Citations
- Wu, J., Li, J., Chen, K., Liu, G., Zhou, Y., Chen, W., Zhu, X., Ni, T.T., Zhang, B., Jin, D., Li, D., Kang, L., Wu, Y., Zhu, P., Xie, P., Zhong, T.P. (2023) Atf7ip and Setdb1 interaction orchestrates the hematopoietic stem and progenitor cell state with diverse lineage differentiation. Proceedings of the National Academy of Sciences of the United States of America. 120:e2209062120e2209062120
- Chen, Y.C., Liao, B.K., Lu, Y.F., Liu, Y.H., Hsieh, F.C., Hwang, P.P., Hwang, S.L. (2019) Zebrafish Klf4 maintains the ionocyte progenitor population by regulating epidermal stem cell proliferation and lateral inhibition. PLoS Genetics. 15:e1008058
- Honjo, Y., Ichinohe, T. (2019) Cellular responses to ionizing radiation change quickly over time during early development in zebrafish. Cell biology international. 43(5):516-527
- Xue, Y., Gao, S., Liu, F. (2015) Genome-wide Analysis of the Zebrafish Klf Family Identifies Two Genes important for Erythroid Maturation. Developmental Biology. 403(2):115-27
- Davidson, W.R., Kari, C., Ren, Q., Daroczi, B., Dicker, A.P., and Rodeck, U. (2010) Differential regulation of p53 function by the N-terminal ΔNp53 and Δ113p53 isoforms in zebrafish embryos. BMC Developmental Biology. 10:102
- Liu, X., Huang, S., Ma, J., Li, C., Zhang, Y., and Luo, L. (2009) NF-kappaB and Snail1a coordinate the cell cycle with gastrulation. The Journal of cell biology. 184(6):805-815
- Sidi, S., Sanda, T., Kennedy, R.D., Hagen, A.T., Jette, C.A., Hoffmans, R., Pascual, J., Imamura, S., Kishi, S., Amatruda, J.F., Kanki, J.P., Green, D.R., D'Andrea, A.A., and Look, A.T. (2008) Chk1 Suppresses a Caspase-2 Apoptotic Response to DNA Damage that Bypasses p53, Bcl-2, and Caspase-3. Cell. 133(5):864-877
1 - 7 of 7
Show