Morpholino

MO1-hspg2

ID
ZDB-MRPHLNO-080807-1
Name
MO1-hspg2
Previous Names
  • DI-MO (1)
Target
Sequence
5' - AGTCTTTCAACTCGACCTTCATTCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hspg2
No data available
Phenotype
Phenotype resulting from MO1-hspg2
Phenotype Fish Figures
acetylcholine receptor activity disrupted, abnormal WT + MO1-hspg2 Fig. 6 from Zoeller et al., 2008
angiogenesis disrupted, abnormal y7Tg + MO1-hspg2 Fig. 1Fig. 4 from Zoeller et al., 2009
Fig. 7Fig. S4Fig. S5 from Zoeller et al., 2008
atrium elongated, abnormal zn1Tg + MO1-hspg2 Fig. S5 from Zoeller et al., 2008
blood vessel decreased amount, abnormal zn1Tg + MO1-hspg2 Fig. 4 from Zoeller et al., 2009
cardiac ventricle elongated, abnormal zn1Tg + MO1-hspg2 Fig. S5 from Zoeller et al., 2008
cardiovascular system morphology, abnormal WT + MO1-hspg2 Fig. S2 from Zoeller et al., 2008
dorsal longitudinal anastomotic vessel aplastic, abnormal y1Tg + MO1-hspg2 Fig. 1 from Zoeller et al., 2009
Fig. 7Fig. S4Fig. S5 from Zoeller et al., 2008
intersegmental vessel decreased length, abnormal y1Tg + MO1-hspg2 Fig. 7Fig. S4Fig. S5 from Zoeller et al., 2008
intersegmental vessel morphology, abnormal y7Tg + MO1-hspg2 Fig. 1 from Zoeller et al., 2009
intersegmental vessel unlumenized, abnormal y7Tg + MO1-hspg2 Fig. 1 from Zoeller et al., 2009
intersegmental vessel blood vessel endothelial cell decreased amount, abnormal y7Tg + MO1-hspg2 Fig. 1 from Zoeller et al., 2009
intracellular protein localization disrupted, abnormal WT + MO1-hspg2 Fig. 2Fig. 3 from Zoeller et al., 2009
myotome shape, abnormal WT + MO1-hspg2 Fig. 6 from Zoeller et al., 2008
pericardium edematous, abnormal WT + MO1-hspg2 Fig. 8Fig. S5 from Zoeller et al., 2008
post-vent region curved dorsal, abnormal WT + MO1-hspg2 + MO4-tp53 Fig. 3Fig. 8Fig. S2 from Zoeller et al., 2008
post-vent region curved ventral, abnormal WT + MO1-hspg2 Fig. 8 from Zoeller et al., 2008
skeletal myofibril assembly disrupted, abnormal WT + MO1-hspg2 Fig. 5 from Zoeller et al., 2008
subintestinal vein aplastic, abnormal WT + MO1-hspg2 Fig. 7Fig. S4 from Zoeller et al., 2008
trunk kinked, abnormal WT + MO1-hspg2 + MO4-tp53 Fig. 3Fig. 8Fig. S2 from Zoeller et al., 2008
trunk musculature dystrophic, abnormal WT + MO1-hspg2 Fig. 5 from Zoeller et al., 2008
trunk musculature actin filament bundle disorganized, abnormal WT + MO1-hspg2 Fig. 6 from Zoeller et al., 2008
trunk musculature myofibril misaligned with trunk musculature myofibril, abnormal WT + MO1-hspg2 Fig. 5 from Zoeller et al., 2008
whole organism decreased length, abnormal WT + MO1-hspg2 Fig. 3Fig. 8Fig. S2 from Zoeller et al., 2008
Phenotype of all Fish created by or utilizing MO1-hspg2
Phenotype Fish Conditions Figures
trunk musculature myofibril misaligned with trunk musculature myofibril, abnormal WT + MO1-hspg2 standard conditions Fig. 5 from Zoeller et al., 2008
acetylcholine receptor activity disrupted, abnormal WT + MO1-hspg2 standard conditions Fig. 6 from Zoeller et al., 2008
cardiovascular system morphology, abnormal WT + MO1-hspg2 standard conditions Fig. S2 from Zoeller et al., 2008
intracellular protein localization disrupted, abnormal WT + MO1-hspg2 standard conditions Fig. 2Fig. 3 from Zoeller et al., 2009
angiogenesis disrupted, abnormal WT + MO1-hspg2 standard conditions Fig. 7 from Zoeller et al., 2008
post-vent region curved ventral, abnormal WT + MO1-hspg2 standard conditions Fig. 8 from Zoeller et al., 2008
whole organism decreased length, abnormal WT + MO1-hspg2 standard conditions Fig. 3Fig. 8Fig. S2 from Zoeller et al., 2008
myotome shape, abnormal WT + MO1-hspg2 standard conditions Fig. 6 from Zoeller et al., 2008
pericardium edematous, abnormal WT + MO1-hspg2 standard conditions Fig. 8 from Zoeller et al., 2008
post-vent region curved dorsal, abnormal WT + MO1-hspg2 standard conditions Fig. 3Fig. 8Fig. S2 from Zoeller et al., 2008
trunk musculature dystrophic, abnormal WT + MO1-hspg2 standard conditions Fig. 5 from Zoeller et al., 2008
subintestinal vein aplastic, abnormal WT + MO1-hspg2 standard conditions Fig. 7 from Zoeller et al., 2008
trunk musculature actin filament bundle disorganized, abnormal WT + MO1-hspg2 standard conditions Fig. 6 from Zoeller et al., 2008
skeletal myofibril assembly disrupted, abnormal WT + MO1-hspg2 standard conditions Fig. 5 from Zoeller et al., 2008
trunk kinked, abnormal WT + MO1-hspg2 standard conditions Fig. 3Fig. 8Fig. S2 from Zoeller et al., 2008
post-vent region curved dorsal, abnormal WT + MO1-hspg2 + MO4-tp53 standard conditions Fig. S2 from Zoeller et al., 2008
trunk kinked, abnormal WT + MO1-hspg2 + MO4-tp53 standard conditions Fig. S2 from Zoeller et al., 2008
dorsal longitudinal anastomotic vessel aplastic, abnormal y1Tg + MO1-hspg2 standard conditions Fig. 7Fig. S4Fig. S5 from Zoeller et al., 2008
angiogenesis disrupted, abnormal y1Tg + MO1-hspg2 standard conditions Fig. 7Fig. S4Fig. S5 from Zoeller et al., 2008
subintestinal vein aplastic, abnormal y1Tg + MO1-hspg2 standard conditions Fig. S4 from Zoeller et al., 2008
intersegmental vessel decreased length, abnormal y1Tg + MO1-hspg2 standard conditions Fig. 7Fig. S4Fig. S5 from Zoeller et al., 2008
intersegmental vessel blood vessel endothelial cell decreased amount, abnormal y7Tg + MO1-hspg2 standard conditions Fig. 1 from Zoeller et al., 2009
dorsal longitudinal anastomotic vessel aplastic, abnormal y7Tg + MO1-hspg2 standard conditions Fig. 1 from Zoeller et al., 2009
intersegmental vessel morphology, abnormal y7Tg + MO1-hspg2 standard conditions Fig. 1 from Zoeller et al., 2009
angiogenesis disrupted, abnormal y7Tg + MO1-hspg2 standard conditions Fig. 1 from Zoeller et al., 2009
intersegmental vessel unlumenized, abnormal y7Tg + MO1-hspg2 standard conditions Fig. 1 from Zoeller et al., 2009
pericardium edematous, abnormal zn1Tg + MO1-hspg2 standard conditions Fig. S5 from Zoeller et al., 2008
cardiac ventricle elongated, abnormal zn1Tg + MO1-hspg2 standard conditions Fig. S5 from Zoeller et al., 2008
intersegmental vessel decreased length, abnormal zn1Tg + MO1-hspg2 standard conditions Fig. S5 from Zoeller et al., 2008
atrium elongated, abnormal zn1Tg + MO1-hspg2 standard conditions Fig. S5 from Zoeller et al., 2008
angiogenesis disrupted, abnormal zn1Tg + MO1-hspg2 standard conditions Fig. 4 from Zoeller et al., 2009
Fig. S5 from Zoeller et al., 2008
dorsal longitudinal anastomotic vessel aplastic, abnormal zn1Tg + MO1-hspg2 standard conditions Fig. S5 from Zoeller et al., 2008
blood vessel decreased amount, abnormal zn1Tg + MO1-hspg2 standard conditions Fig. 4 from Zoeller et al., 2009
Citations