Morpholino

MO1-atr

ID
ZDB-MRPHLNO-080801-5
Name
MO1-atr
Previous Names
None
Target
Sequence
5' - TGACATTTCTAGTCCTTGCTCCATC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-atr
No data available
Phenotype
Phenotype resulting from MO1-atr
Phenotype Fish Figures
determination of left/right asymmetry in lateral mesoderm decreased occurrence, abnormal WT + MO1-atr Fig. 5 with image from Stiff et al., 2016
determination of left/right asymmetry in lateral mesoderm process quality, abnormal WT + MO1-atr Fig. 5 with image from Stiff et al., 2016
determination of pancreatic left/right asymmetry decreased occurrence, abnormal WT + MO1-atr Fig. 5 with image from Stiff et al., 2016
eye decreased size, abnormal WT + MO1-atr Fig. 4 with image from Stiff et al., 2016
head decreased size, abnormal WT + MO1-atr Fig. 4 with image from Stiff et al., 2016
heart looping decreased occurrence, abnormal WT + MO1-atr Fig. 5 with image from Stiff et al., 2016
heart looping process quality, abnormal WT + MO1-atr Fig. 5 with image from Stiff et al., 2016
Kupffer's vesicle decreased size, abnormal WT + MO1-atr Fig. 3 with image from Stiff et al., 2016
Kupffer's vesicle motile cilium decreased length, abnormal WT + MO1-atr Fig. 3 with image from Stiff et al., 2016
lateral plate mesoderm spaw expression mislocalised, abnormal WT + MO1-atr Fig. 5 with image from Stiff et al., 2016
lateral plate mesoderm right side spaw expression mislocalised, abnormal WT + MO1-atr Fig. 5 with image from Stiff et al., 2016
pancreas mislocalised, abnormal WT + MO1-atr Fig. 5 with image from Stiff et al., 2016
pericardium edematous, abnormal WT + MO1-atr Fig. S2 with image from Stiff et al., 2016
whole organism cdkn1a expression decreased amount, abnormal WT + MO1-atr Fig. 3 with image from Stiff et al., 2016
whole organism bbc3 expression decreased amount, abnormal WT + MO1-atr Fig. 3 with image from Stiff et al., 2016
whole organism gli1 expression decreased amount, abnormal WT + MO1-atr Fig. 3 with image from Stiff et al., 2016
whole organism anterior-posterior axis increased curvature, abnormal WT + MO1-atr Fig. 4 with imageFig. S2 with image from Stiff et al., 2016
Phenotype of all Fish created by or utilizing MO1-atr
Phenotype Fish Conditions Figures
heart looping process quality, abnormal WT + MO1-atr standard conditions Fig. 5 with image from Stiff et al., 2016
determination of left/right asymmetry in lateral mesoderm process quality, abnormal WT + MO1-atr standard conditions Fig. 5 with image from Stiff et al., 2016
lateral plate mesoderm right side spaw expression mislocalised, abnormal WT + MO1-atr standard conditions Fig. 5 with image from Stiff et al., 2016
eye decreased size, abnormal WT + MO1-atr standard conditions Fig. 4 with image from Stiff et al., 2016
whole organism gli1 expression decreased amount, abnormal WT + MO1-atr standard conditions Fig. 3 with image from Stiff et al., 2016
pericardium edematous, abnormal WT + MO1-atr standard conditions Fig. S2 with image from Stiff et al., 2016
determination of pancreatic left/right asymmetry decreased occurrence, abnormal WT + MO1-atr standard conditions Fig. 5 with image from Stiff et al., 2016
lateral plate mesoderm spaw expression mislocalised, abnormal WT + MO1-atr standard conditions Fig. 5 with image from Stiff et al., 2016
Kupffer's vesicle motile cilium decreased length, abnormal WT + MO1-atr standard conditions Fig. 3 with image from Stiff et al., 2016
whole organism anterior-posterior axis increased curvature, abnormal WT + MO1-atr standard conditions Fig. 4 with imageFig. S2 with image from Stiff et al., 2016
whole organism bbc3 expression decreased amount, abnormal WT + MO1-atr standard conditions Fig. 3 with image from Stiff et al., 2016
head decreased size, abnormal WT + MO1-atr standard conditions Fig. 4 with image from Stiff et al., 2016
pancreas mislocalised, abnormal WT + MO1-atr standard conditions Fig. 5 with image from Stiff et al., 2016
whole organism cdkn1a expression decreased amount, abnormal WT + MO1-atr standard conditions Fig. 3 with image from Stiff et al., 2016
determination of left/right asymmetry in lateral mesoderm decreased occurrence, abnormal WT + MO1-atr standard conditions Fig. 5 with image from Stiff et al., 2016
heart looping decreased occurrence, abnormal WT + MO1-atr standard conditions Fig. 5 with image from Stiff et al., 2016
Kupffer's vesicle decreased size, abnormal WT + MO1-atr standard conditions Fig. 3 with image from Stiff et al., 2016
whole organism apoptotic, abnormal tp53zdf1/zdf1 + MO1-atr radiation Fig. 1 with image from Sidi et al., 2008
intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator disrupted, abnormal tp53zdf1/zdf1 + MO1-atr radiation Fig. 1 with image from Sidi et al., 2008
whole organism decreased sensitivity to irradiation, abnormal tp53zdf1/zdf1 + MO1-atr radiation Fig. 1 with image from Sidi et al., 2008
spinal cord apoptotic, abnormal tp53zdf1/zdf1 + MO1-atr + MO2-chek1 radiation Fig. 4 with image from Sidi et al., 2008
Citations