header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-080728-3
Morpholino Name: MO2-gata2a
Target: gata2a (1)
Previous Names: gata2e1D, MO2-gata2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AATGAATCCTACCGTGCGCTTGTCC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-gata2a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-gata2a
Expressed Gene Anatomy Figures
znfl2a Fig. S3 from Galloway et al., 2008
PHENOTYPE
Phenotype resulting from MO2-gata2a
Phenotype of all Fish created by or utilizing MO2-gata2a
OTHER MO2-gata2a MORPHOLINO PAGESNo links to external sites
CITATIONS (3)