header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-080708-7
Morpholino Name: MO1-robo1
Target: robo1 (1)
Sequence:
5' - ATCCAATTATTCTCCCCGTCATCGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-robo1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-robo1 No data available
PHENOTYPE
Phenotype resulting from MO1-robo1
Phenotype of all Fish created by or utilizing MO1-robo1
Phenotype Fish Conditions Figures
endocardium morphogenesis decreased process quality, abnormal s896Tg; twu26Tg + MO1-robo1 standard conditions Fig. 3 with image from Fish et al., 2011
endocardium mislocalised, abnormal s896Tg; twu26Tg + MO1-robo1 standard conditions Fig. 3 with image from Fish et al., 2011
cardioblast migration to the midline involved in heart field formation decreased process quality, abnormal s896Tg; twu26Tg + MO1-robo1 standard conditions Fig. 3 with image from Fish et al., 2011
myocardium mislocalised, abnormal s896Tg; twu26Tg + MO1-robo1 standard conditions Fig. 3 with image from Fish et al., 2011
endocardium cell malformed, abnormal s896Tg; twu26Tg + MO1-robo1 standard conditions Fig. 3 with image from Fish et al., 2011
cardiac muscle tissue morphogenesis decreased process quality, abnormal s896Tg; twu26Tg + MO1-robo1 standard conditions Fig. 3 with image from Fish et al., 2011
endocardium mislocalised, abnormal s896Tg; twu26Tg + MO1-robo1 + MO3-vegfaa standard conditions Fig. 5 with image from Fish et al., 2011
embryonic heart tube morphogenesis decreased process quality, abnormal s896Tg; twu26Tg + MO1-robo1 + MO3-vegfaa standard conditions Fig. 5 with image from Fish et al., 2011
cardioblast migration to the midline involved in heart field formation decreased process quality, abnormal s896Tg; twu26Tg + MO1-robo1 + MO3-vegfaa standard conditions Fig. 5 with image from Fish et al., 2011
myocardium mislocalised, abnormal s896Tg; twu26Tg + MO1-robo1 + MO3-vegfaa standard conditions Fig. 5 with image from Fish et al., 2011
cardioblast migration delayed, abnormal s896Tg; twu26Tg + MO1-mir218 + MO1-robo1 standard conditions Fig. 4 with image from Fish et al., 2011
OTHER MO1-robo1 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)