Morpholino
MO1-myf6
- ID
- ZDB-MRPHLNO-080707-2
- Name
- MO1-myf6
- Previous Names
-
- mrf4 MO1 (1)
- Target
- Sequence
-
5' - CGTTGGTCTCAAACAGGTCCATCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This is a translation blocking morpholino that targets myf6.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-myf6
No data available
Phenotype
Phenotype resulting from MO1-myf6
Phenotype | Fish | Figures |
---|---|---|
somite border amorphous, abnormal | WT + MO1-myf6 |
Fig. 2 ![]() |
trunk curved ventral, abnormal | WT + MO1-myf6 |
Fig. 2 ![]() |
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO1-myf6
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
trunk curved ventral, abnormal | WT + MO1-myf6 | standard conditions |
Fig. 2 ![]() |
somite border amorphous, abnormal | WT + MO1-myf6 | standard conditions |
Fig. 2 ![]() |
1 - 2 of 2
Citations
- Schnapp, E., Pistocchi, A.S., Karampetsou, E., Foglia, E., Lamia, C.L., Cotelli, F., and Cossu, G. (2009) Induced early expression of mrf4 but not myog rescues myogenesis in the myod/myf5 double-morphant zebrafish embryo. Journal of Cell Science. 122(Pt 4):481-488
- Wang, Y.H., Li, C.K., Lee, G.H., Tsay, H.J., Tsai, H.J., and Chen, Y.H. (2008) Inactivation of zebrafish mrf4 leads to myofibril misalignment and motor axon growth disorganization. Developmental Dynamics : an official publication of the American Association of Anatomists. 237(4):1043-1050
1 - 2 of 2
Show