Morpholino
MO2-kdrl
- ID
- ZDB-MRPHLNO-080516-9
- Name
- MO2-kdrl
- Previous Names
-
- MO-kdra (1)
- MO2-kdr
- Target
- Sequence
-
5' - CCGAATGATACTCCGTATGTCACTT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-kdrl
No data available
Phenotype
Phenotype resulting from MO2-kdrl
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO2-kdrl
1 - 5 of 14 Show all
Citations
- Field, C.J., Perez, A.M., Samet, T., Ricles, V., Iovine, M.K., Lowe-Krentz, L.J. (2022) Involvement of transmembrane protein 184a during angiogenesis in zebrafish embryos. Frontiers in Physiology. 13:845407
- Monteiro, R., Pinheiro, P., Joseph, N., Peterkin, T., Koth, J., Repapi, E., Bonkhofer, F., Kirmizitas, A., Patient, R. (2016) Transforming Growth Factor β Drives Hemogenic Endothelium Programming and the Transition to Hematopoietic Stem Cells. Developmental Cell. 38(4):358-70
- Kilari, S., Remadevi, I., Zhao, B., Pan, J., Miao, R., Ramchandran, R., North, P.E., You, M., Rahimi, N., and Wilkinson, G.A. (2013) Endothelial Cell-Specific Chemotaxis Receptor (ECSCR) enhances Vascular Endothelial Growth Factor (VEGF) Receptor-2/Kinase insert domain receptor (KDR) activation and promotes proteolysis of internalized KDR. The Journal of biological chemistry. 288(15):10265-10274
- Bridge, G., Monteiro, R., Henderson, S., Emuss, V., Lagos, D., Georgopoulou, D., Patient, R., and Boshoff, C. (2012) The microRNA-30 family targets DLL4 to modulate endothelial cell behavior during angiogenesis. Blood. 120(25):5063-5072
- Wilkinson, R.N., Koudijs, M.J., Patient, R.K., Ingham, P.W., Schulte-Merker, S., and van Eeden, F.J. (2012) Hedgehog signaling via a calcitonin receptor-like receptor can induce arterial differentiation independently of VEGF signaling in zebrafish. Blood. 120(2):477-488
- Bahary, N., Goishi, K., Stuckenholz, C., Weber, G., Leblanc, J., Schafer, C.A., Berman, S.S., Klagsbrun, M., and Zon, L.I. (2007) Duplicate VegfA genes and orthologues of the KDR receptor tyrosine kinase family mediate vascular development in the zebrafish. Blood. 110(10):3627-3636
1 - 6 of 6
Show