Morpholino

MO2-cxadr

ID

ZDB-MRPHLNO-080509-5

Name

MO2-cxadr

Previous Names

None

Target

cxadr (1)

Sequence

5' - GACGTCCTCATATCCATTCCTCTGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-cxadr

Expressed Gene	Anatomy	Figures
cxadr	(not) whole organism	Fig. 3 from Raschperger et al., 2008

Phenotype

Phenotype resulting from MO2-cxadr

Phenotype	Fish	Figures
alkaline phosphatase activity decreased occurrence, abnormal	AB + MO2-cxadr	Fig. 5 from Raschperger et al., 2008
cloacal chamber deformed, abnormal	AB + MO2-cxadr	text only from Raschperger et al., 2008
gut epithelium structure, abnormal	AB + MO2-cxadr	Fig. 4 from Raschperger et al., 2008
gut epithelium plasma membrane increased distance gut epithelium plasma membrane, abnormal	AB + MO2-cxadr	Fig. 4 from Raschperger et al., 2008
heart edematous, abnormal	AB + MO2-cxadr	Fig. 3 from Raschperger et al., 2008
podocyte morphology, abnormal	AB + MO2-cxadr	Fig. 4 from Raschperger et al., 2008
post-vent region curvature, abnormal	AB + MO2-cxadr	text only from Raschperger et al., 2008
pronephric glomerulus morphology, abnormal	AB + MO2-cxadr	Fig. 3 , Fig. 4 from Raschperger et al., 2008
pronephric tubule brush border epithelial cell disorganized, abnormal	AB + MO2-cxadr	Fig. 5 from Raschperger et al., 2008
pronephric tubule epithelium structure, abnormal	AB + MO2-cxadr	Fig. 4 from Raschperger et al., 2008
pronephric tubule microvillus decreased amount, abnormal	AB + MO2-cxadr	Fig. 4 from Raschperger et al., 2008
pronephric tubule plasma membrane increased distance pronephric tubule plasma membrane, abnormal	AB + MO2-cxadr	Fig. 4 from Raschperger et al., 2008
pronephros cystic, abnormal	AB + MO2-cxadr	Fig. 3 from Raschperger et al., 2008
somite morphology, abnormal	AB + MO2-cxadr	text only from Raschperger et al., 2008
whole organism edematous, abnormal	AB + MO2-cxadr	text only from Raschperger et al., 2008

Phenotype of all Fish created by or utilizing MO2-cxadr

Phenotype	Fish	Conditions	Figures
pronephric tubule microvillus decreased amount, abnormal	AB + MO2-cxadr	standard conditions	Fig. 4 from Raschperger et al., 2008
podocyte morphology, abnormal	AB + MO2-cxadr	standard conditions	Fig. 4 from Raschperger et al., 2008
pronephros cystic, abnormal	AB + MO2-cxadr	standard conditions	Fig. 3 from Raschperger et al., 2008
pronephric tubule plasma membrane increased distance pronephric tubule plasma membrane, abnormal	AB + MO2-cxadr	standard conditions	Fig. 4 from Raschperger et al., 2008
gut epithelium structure, abnormal	AB + MO2-cxadr	standard conditions	Fig. 4 from Raschperger et al., 2008
gut epithelium plasma membrane increased distance gut epithelium plasma membrane, abnormal	AB + MO2-cxadr	standard conditions	Fig. 4 from Raschperger et al., 2008
alkaline phosphatase activity decreased occurrence, abnormal	AB + MO2-cxadr	standard conditions	Fig. 5 from Raschperger et al., 2008
post-vent region curvature, abnormal	AB + MO2-cxadr	standard conditions	text only from Raschperger et al., 2008
whole organism edematous, abnormal	AB + MO2-cxadr	standard conditions	text only from Raschperger et al., 2008
somite morphology, abnormal	AB + MO2-cxadr	standard conditions	text only from Raschperger et al., 2008
pronephric tubule epithelium structure, abnormal	AB + MO2-cxadr	standard conditions	Fig. 4 from Raschperger et al., 2008
cloacal chamber deformed, abnormal	AB + MO2-cxadr	standard conditions	text only from Raschperger et al., 2008
pronephric tubule brush border epithelial cell disorganized, abnormal	AB + MO2-cxadr	standard conditions	Fig. 5 from Raschperger et al., 2008
pronephric glomerulus morphology, abnormal	AB + MO2-cxadr	standard conditions	Fig. 3 , Fig. 4 from Raschperger et al., 2008
heart edematous, abnormal	AB + MO2-cxadr	standard conditions	Fig. 3 from Raschperger et al., 2008

Citations