Morpholino

MO2-cxadr

ID
ZDB-MRPHLNO-080509-5
Name
MO2-cxadr
Previous Names
None
Target
Sequence
5' - GACGTCCTCATATCCATTCCTCTGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-cxadr
No data available
Phenotype
Phenotype resulting from MO2-cxadr
Phenotype Fish Figures
alkaline phosphatase activity decreased occurrence, abnormal AB + MO2-cxadr Fig. 5 with image from Raschperger et al., 2008
cloacal chamber deformed, abnormal AB + MO2-cxadr text only from Raschperger et al., 2008
gut epithelium structure, abnormal AB + MO2-cxadr Fig. 4 with image from Raschperger et al., 2008
gut epithelium plasma membrane increased distance gut epithelium plasma membrane, abnormal AB + MO2-cxadr Fig. 4 with image from Raschperger et al., 2008
heart edematous, abnormal AB + MO2-cxadr Fig. 3 with image from Raschperger et al., 2008
podocyte morphology, abnormal AB + MO2-cxadr Fig. 4 with image from Raschperger et al., 2008
post-vent region curvature, abnormal AB + MO2-cxadr text only from Raschperger et al., 2008
pronephric glomerulus morphology, abnormal AB + MO2-cxadr Fig. 3 with imageFig. 4 with image from Raschperger et al., 2008
pronephric tubule brush border epithelial cell disorganized, abnormal AB + MO2-cxadr Fig. 5 with image from Raschperger et al., 2008
pronephric tubule epithelium structure, abnormal AB + MO2-cxadr Fig. 4 with image from Raschperger et al., 2008
pronephric tubule microvillus decreased amount, abnormal AB + MO2-cxadr Fig. 4 with image from Raschperger et al., 2008
pronephric tubule plasma membrane increased distance pronephric tubule plasma membrane, abnormal AB + MO2-cxadr Fig. 4 with image from Raschperger et al., 2008
pronephros cystic, abnormal AB + MO2-cxadr Fig. 3 with image from Raschperger et al., 2008
somite morphology, abnormal AB + MO2-cxadr text only from Raschperger et al., 2008
whole organism edematous, abnormal AB + MO2-cxadr text only from Raschperger et al., 2008
Phenotype of all Fish created by or utilizing MO2-cxadr
Phenotype Fish Conditions Figures
pronephric tubule microvillus decreased amount, abnormal AB + MO2-cxadr standard conditions Fig. 4 with image from Raschperger et al., 2008
podocyte morphology, abnormal AB + MO2-cxadr standard conditions Fig. 4 with image from Raschperger et al., 2008
pronephros cystic, abnormal AB + MO2-cxadr standard conditions Fig. 3 with image from Raschperger et al., 2008
pronephric tubule plasma membrane increased distance pronephric tubule plasma membrane, abnormal AB + MO2-cxadr standard conditions Fig. 4 with image from Raschperger et al., 2008
gut epithelium structure, abnormal AB + MO2-cxadr standard conditions Fig. 4 with image from Raschperger et al., 2008
gut epithelium plasma membrane increased distance gut epithelium plasma membrane, abnormal AB + MO2-cxadr standard conditions Fig. 4 with image from Raschperger et al., 2008
alkaline phosphatase activity decreased occurrence, abnormal AB + MO2-cxadr standard conditions Fig. 5 with image from Raschperger et al., 2008
post-vent region curvature, abnormal AB + MO2-cxadr standard conditions text only from Raschperger et al., 2008
whole organism edematous, abnormal AB + MO2-cxadr standard conditions text only from Raschperger et al., 2008
somite morphology, abnormal AB + MO2-cxadr standard conditions text only from Raschperger et al., 2008
pronephric tubule epithelium structure, abnormal AB + MO2-cxadr standard conditions Fig. 4 with image from Raschperger et al., 2008
cloacal chamber deformed, abnormal AB + MO2-cxadr standard conditions text only from Raschperger et al., 2008
pronephric tubule brush border epithelial cell disorganized, abnormal AB + MO2-cxadr standard conditions Fig. 5 with image from Raschperger et al., 2008
pronephric glomerulus morphology, abnormal AB + MO2-cxadr standard conditions Fig. 3 with imageFig. 4 with image from Raschperger et al., 2008
heart edematous, abnormal AB + MO2-cxadr standard conditions Fig. 3 with image from Raschperger et al., 2008
Citations