Morpholino

MO1-dlx1a

ID
ZDB-MRPHLNO-080429-1
Name
MO1-dlx1a
Previous Names
None
Target
Sequence
5' - TAGACTCTCTGGTATTGTAGACATG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dlx1a
Expressed Gene Anatomy Figures
alcama Fig. 7 with image from Sperber et al., 2008
barx1 Fig. 6 with image from Sperber et al., 2008
gad1b Fig. S3 with image from MacDonald et al., 2013
gad2 Fig. 4 with image from MacDonald et al., 2013
gsc Fig. 6 with image from Sperber et al., 2008
hand2 Fig. S2 with image from Sperber et al., 2008
neurod1 Fig. 5 with image from Sperber et al., 2008
nkx2.3 Fig. 5 with image from Sperber et al., 2008
sox9a Fig. 5 with image from Sperber et al., 2008
Phenotype
Phenotype resulting from MO1-dlx1a
Phenotype Fish Figures
ceratobranchial cartilage chondrocyte decreased amount, abnormal WT + MO1-dlx1a Fig. 2 with image from Sperber et al., 2008
ceratohyal cartilage deformed, abnormal WT + MO1-dlx1a Fig. 2 with image from Sperber et al., 2008
ethmoid cartilage decreased size, abnormal WT + MO1-dlx1a Fig. 2 with image from Sperber et al., 2008
head decreased size, abnormal WT + MO1-dlx1a Fig. 2 with image from Sperber et al., 2008
hyosymplectic cartilage deformed, abnormal WT + MO1-dlx1a Fig. 2 with image from Sperber et al., 2008
Meckel's cartilage deformed, abnormal WT + MO1-dlx1a Fig. 2 with image from Sperber et al., 2008
palatoquadrate cartilage deformed, abnormal WT + MO1-dlx1a Fig. 2 with image from Sperber et al., 2008
pharyngeal arch cartilage decreased size, abnormal WT + MO1-dlx1a Fig. 2 with image from Sperber et al., 2008
pharyngeal arch cartilage deformed, abnormal WT + MO1-dlx1a Fig. 2 with image from Sperber et al., 2008
trabecula cranii decreased size, abnormal WT + MO1-dlx1a Fig. 2 with image from Sperber et al., 2008
Phenotype of all Fish created by or utilizing MO1-dlx1a
Phenotype Fish Conditions Figures
ceratohyal cartilage deformed, abnormal WT + MO1-dlx1a standard conditions Fig. 2 with image from Sperber et al., 2008
pharyngeal arch cartilage decreased size, abnormal WT + MO1-dlx1a standard conditions Fig. 2 with image from Sperber et al., 2008
head decreased size, abnormal WT + MO1-dlx1a standard conditions Fig. 2 with image from Sperber et al., 2008
ethmoid cartilage decreased size, abnormal WT + MO1-dlx1a standard conditions Fig. 2 with image from Sperber et al., 2008
pharyngeal arch cartilage deformed, abnormal WT + MO1-dlx1a standard conditions Fig. 2 with image from Sperber et al., 2008
Meckel's cartilage deformed, abnormal WT + MO1-dlx1a standard conditions Fig. 2 with image from Sperber et al., 2008
hyosymplectic cartilage deformed, abnormal WT + MO1-dlx1a standard conditions Fig. 2 with image from Sperber et al., 2008
palatoquadrate cartilage deformed, abnormal WT + MO1-dlx1a standard conditions Fig. 2 with image from Sperber et al., 2008
trabecula cranii decreased size, abnormal WT + MO1-dlx1a standard conditions Fig. 2 with image from Sperber et al., 2008
ceratobranchial cartilage chondrocyte decreased amount, abnormal WT + MO1-dlx1a standard conditions Fig. 2 with image from Sperber et al., 2008
palatoquadrate cartilage morphology, abnormal AB + MO1-dlx1a + MO2-dlx2a standard conditions Fig. 1 with image from Talbot et al., 2010
hyosymplectic cartilage morphology, abnormal AB + MO1-dlx1a + MO2-dlx2a standard conditions Fig. 1 with image from Talbot et al., 2010
embryonic viscerocranium morphogenesis disrupted, abnormal AB + MO1-dlx1a + MO2-dlx2a standard conditions Fig. 1 with image from Talbot et al., 2010
hypothalamus morphology, abnormal WT + MO1-dlx1a + MO2-dlx2a standard conditions Fig. S2 with image from MacDonald et al., 2013
ceratobranchial cartilage chondrocyte decreased amount, abnormal WT + MO1-dlx1a + MO2-dlx2a standard conditions Fig. 2 with image from Sperber et al., 2008
trabecula cranii decreased size, abnormal WT + MO1-dlx1a + MO2-dlx2a standard conditions Fig. 2 with image from Sperber et al., 2008
pharyngeal arch cartilage chondrocyte decreased amount, abnormal WT + MO1-dlx1a + MO2-dlx2a standard conditions Fig. 2 with image from Sperber et al., 2008
head decreased size, abnormal WT + MO1-dlx1a + MO2-dlx2a standard conditions Fig. 2 with image from Sperber et al., 2008
head apoptotic, abnormal WT + MO1-dlx1a + MO2-dlx2a standard conditions Fig. 4 with image from Sperber et al., 2008
ceratohyal cartilage deformed, abnormal WT + MO1-dlx1a + MO2-dlx2a standard conditions Fig. 2 with image from Sperber et al., 2008
hyosymplectic cartilage deformed, abnormal WT + MO1-dlx1a + MO2-dlx2a standard conditions Fig. 2 with image from Sperber et al., 2008
ethmoid cartilage decreased size, abnormal WT + MO1-dlx1a + MO2-dlx2a standard conditions Fig. 2 with image from Sperber et al., 2008
interhyal cartilage aplastic, abnormal WT + MO1-dlx1a + MO2-dlx2a standard conditions Fig. 2 with image from Sperber et al., 2008
ceratobranchial cartilage deformed, abnormal WT + MO1-dlx1a + MO2-dlx2a standard conditions Fig. 2 with image from Sperber et al., 2008
pharyngeal arch cartilage decreased size, abnormal WT + MO1-dlx1a + MO2-dlx2a standard conditions Fig. 2 with image from Sperber et al., 2008
pharyngeal arch cartilage deformed, abnormal WT + MO1-dlx1a + MO2-dlx2a standard conditions Fig. 2 with image from Sperber et al., 2008
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.