header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-080414-1
Morpholino Name: MO5-otpb
Target: otpb (1)
Sequence:
5' - TGCAGCATCCTTCATCCCTGTGGAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: otpb/sp2 Intron1-Exon2 splice-blocker
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO5-otpb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO5-otpb
Expressed Gene Anatomy Figures
oxt Fig. 4 with image from Blechman et al., 2007
slc6a3 Fig. S3 with image from Blechman et al., 2007
th Fig. 4 with image from Blechman et al., 2007
PHENOTYPE
Phenotype resulting from MO5-otpb
Phenotype of all Fish created by or utilizing MO5-otpb
Genome Resources:
CITATIONS (1)