Morpholino

MO2-axin1

ID
ZDB-MRPHLNO-080326-3
Name
MO2-axin1
Previous Names
None
Target
Sequence
5' - ACTCATGCTCATAGTGTCCCTGCAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-axin1
Expressed Gene Anatomy Figures
ctnnb1 Fig. 5 with image from Schneider et al., 2008
Phenotype
Phenotype resulting from MO2-axin1
No data available
Phenotype of all Fish created by or utilizing MO2-axin1
No data available
Citations