ZFIN ID: ZDB-MRPHLNO-080311-1
Morpholino Name: MO1-etv4
Target: etv4 (1)
Previous Name: MO1-pea3 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AATCCATGCCTTAACCGTTTGTGGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-etv4 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-etv4
Expressed Gene Anatomy Figures
cdh17 Fig. 3 from Chen et al., 2011
wt1a Fig. 3 from Chen et al., 2011
PHENOTYPE
Phenotype resulting from MO1-etv4
No data available

Phenotype of all Fish created by or utilizing MO1-etv4
Genome Resources:
CITATIONS (3)