Morpholino

MO1-tbx3a

ID

ZDB-MRPHLNO-080303-4

Name

MO1-tbx3a

Previous Names

Target

Sequence

5' - TGGATCTCTCATCGGGAAGTCCAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-tbx3a

Expressed Gene	Anatomy	Figures
bmp4	atrioventricular canal myocardium	Fig. 2 from Ribeiro et al., 2007
notch1b	cardiac ventricle	Fig. 1 from Ribeiro et al., 2007

Phenotype

Phenotype resulting from MO1-tbx3a

Phenotype	Fish	Figures
atrioventricular canal increased width, abnormal	WT + MO1-tbx3a	Fig. 1 from Ribeiro et al., 2007
developmental growth neotenous growth, abnormal	WT + MO1-tbx3a	Fig. 1 , text only from Ribeiro et al., 2007
fin bud aplastic, abnormal	WT + MO1-tbx3a	Fig. 1 , text only from Ribeiro et al., 2007
fin bud decreased size, abnormal	WT + MO1-tbx3a	Fig. 1 , text only from Ribeiro et al., 2007
heart looping arrested, abnormal	WT + MO1-tbx3a	Fig. 1 from Ribeiro et al., 2007
heart looping delayed, abnormal	WT + MO1-tbx3a	Fig. 1 from Ribeiro et al., 2007
otic vesicle malformed, abnormal	WT + MO1-tbx3a	Fig. 1 , text only from Ribeiro et al., 2007
pericardium swollen, abnormal	WT + MO1-tbx3a	Fig. 1 from Ribeiro et al., 2007

Phenotype of all Fish created by or utilizing MO1-tbx3a

Phenotype	Fish	Conditions	Figures
atrioventricular canal increased width, abnormal	WT + MO1-tbx3a	standard conditions	Fig. 1 from Ribeiro et al., 2007
fin bud aplastic, abnormal	WT + MO1-tbx3a	standard conditions	Fig. 1 , text only from Ribeiro et al., 2007
pericardium swollen, abnormal	WT + MO1-tbx3a	standard conditions	Fig. 1 from Ribeiro et al., 2007
heart looping delayed, abnormal	WT + MO1-tbx3a	standard conditions	Fig. 1 from Ribeiro et al., 2007
heart looping arrested, abnormal	WT + MO1-tbx3a	standard conditions	Fig. 1 from Ribeiro et al., 2007
otic vesicle malformed, abnormal	WT + MO1-tbx3a	standard conditions	Fig. 1 , text only from Ribeiro et al., 2007
developmental growth neotenous growth, abnormal	WT + MO1-tbx3a	standard conditions	Fig. 1 , text only from Ribeiro et al., 2007
fin bud decreased size, abnormal	WT + MO1-tbx3a	standard conditions	Fig. 1 , text only from Ribeiro et al., 2007
otic placode decreased size, abnormal	WT + MO1-tbx2a + MO1-tbx3a	standard conditions	Fig. 1 from Ribeiro et al., 2007
atrioventricular canal aplastic, abnormal	WT + MO1-tbx2a + MO1-tbx3a	standard conditions	Fig. 1 from Ribeiro et al., 2007
developmental growth neotenous growth, abnormal	WT + MO1-tbx2a + MO1-tbx3a	standard conditions	Fig. 1 from Ribeiro et al., 2007
fin bud aplastic, abnormal	WT + MO1-tbx2a + MO1-tbx3a	standard conditions	Fig. 1 from Ribeiro et al., 2007

Citations