ZFIN ID: ZDB-MRPHLNO-080212-3
Morpholino Name: MO1-fsta
Target: fsta (1)
Previous Name: MOa-fst1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CTGACGCTTTAGCATCCTTAGCATG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-fsta No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-fsta
Expressed Gene Anatomy Figures
edn1 Fig. 8 with image from Dalcq et al., 2012
hand2 Fig. 8 with image from Dalcq et al., 2012
PHENOTYPE
Phenotype resulting from MO1-fsta
Phenotype Figures
ceratobranchial cartilage hyperplastic, abnormal Fig. 7 with image from Dalcq et al., 2012
splanchnocranium hyperplastic, abnormal Fig. 7 with image from Dalcq et al., 2012

Phenotype of all Fish created by or utilizing MO1-fsta
Phenotype Fish Conditions Figures
ceratobranchial cartilage hyperplastic, abnormal WT + MO1-fsta standard conditions Fig. 7 with image from Dalcq et al., 2012
splanchnocranium hyperplastic, abnormal WT + MO1-fsta standard conditions Fig. 7 with image from Dalcq et al., 2012
pharyngeal arch 3-7 skeleton aplastic, abnormal WT + MO1-fsta + MO2-fsta standard conditions text only from Dal-Pra et al., 2006
OTHER MO1-fsta MORPHOLINO PAGESNo links to external sites
CITATIONS (2)