Morpholino
MO1-gsk3ba
- ID
- ZDB-MRPHLNO-071220-2
- Name
- MO1-gsk3ba
- Previous Names
-
- MO1-gsk3b
- Target
- Sequence
-
5' - GTTCTGGGCCGACCGGACATTTTTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gsk3ba
No data available
Phenotype
Phenotype resulting from MO1-gsk3ba
1 - 5 of 11 Show all
Phenotype of all Fish created by or utilizing MO1-gsk3ba
1 - 5 of 17 Show all
Citations
- Bowley, G., Irving, S., Hoefer, I., Wilkinson, R., Pasterkamp, G., Darwish, H.M.S., White, S., Francis, S.E., Chico, T., Noel, E., Serbanovic-Canic, J., Evans, P.C. (2024) Zebrafish model for functional screening of flow-responsive genes controlling endothelial cell proliferation. Scientific Reports. 14:3013030130
- Sarmah, S., Curtis, C., Mahin, J., Farrell, M., Engler, T.A., Sanchez-Felix, M.V., Sato, M., Ma, Y.L., Chu, S., Marrs, J.A. (2019) The Glycogen Synthase Kinase-3β Inhibitor LSN 2105786 Promotes Zebrafish Fin Regeneration. Biomedicines. 7(2)
- Jayachandran, P., Olmo, V.N., Sanchez, S.P., McFarland, R.J., Vital, E., Werner, J.M., Hong, E., Sanchez-Alberola, N., Molodstov, A., Brewster, R.M. (2016) Microtubule-associated protein 1b is required for shaping the neural tube. Neural Development. 11:1
- Lin, K.Y., Kao, S.H., Lai, C.M., Chen, C.T., Wu, C.Y., Hsu, H.J., Wang, W.D. (2015) Tumor Suppressor Lzap Suppresses Wnt/β-catenin signaling to Promote Zebrafish Embryonic Ventral Cell Fates via the Suppression of Inhibitory Phosphorylation of GSK3. The Journal of biological chemistry. 290(50):29808-19
- Lee, H.C., Lin, Y.Z., Lai, Y.T., Huang, W.J., Hu, J.R., Tsai, J.N., Tsai, H.J. (2014) Glycogen Synthase Kinase 3 beta in somites plays a role during the angiogenesis of zebrafish embryos. The FEBS journal. 281(19):4367-83
- Lee, H.C., Tsai, J.N., Liao, P.Y., Tsai, W.Y., Lin, K.Y., Chuang, C.C., Sun, C.K., Chang, W.C., and Tsai, H.J. (2007) Glycogen synthase kinase 3alpha and 3beta have distinct functions during cardiogenesis of zebrafish embryo. BMC Developmental Biology. 7(1):93
1 - 6 of 6
Show