Morpholino
MO1-sema3fb
- ID
- ZDB-MRPHLNO-071205-6
- Name
- MO1-sema3fb
- Previous Names
-
- sema3f2 AMO (1)
- Target
- Sequence
-
5' - CATAGACTGTCCAAGAGCATGGTGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-sema3fb
No data available
Phenotype
Phenotype resulting from MO1-sema3fb
No data available
Phenotype of all Fish created by or utilizing MO1-sema3fb
from 1 - 3 of 3
Citations
- Halabi, R., Cechmanek, P.B., Hehr, C.L., McFarlane, S. (2022) Semaphorin3f as a cardiomyocyte derived regulator of heart chamber development. Cell communication and signaling : CCS. 20:126
- Watterston, C., Halabi, R., McFarlane, S., Childs, S.J. (2021) Endothelial Semaphorin 3fb regulates Vegf pathway-mediated angiogenic sprouting. PLoS Genetics. 17:e1009769
- Terriente, J., Gerety, S.S., Watanabe-Asaka, T., Gonzalez-Quevedo, R., and Wilkinson, D.G. (2012) Signalling from hindbrain boundaries regulates neuronal clustering that patterns neurogenesis. Development (Cambridge, England). 139(16):2978-2987
- Tanaka, H., Maeda, R., Shoji, W., Wada, H., Masai, I., Shiraki, T., Kobayashi, M., Nakayama, R., and Okamoto, H. (2007) Novel mutations affecting axon guidance in zebrafish and a role for plexin signalling in the guidance of trigeminal and facial nerve axons. Development (Cambridge, England). 134(18):3259-3269
1 - 4 of 4
Show