Morpholino

MO2-xrcc6

ID
ZDB-MRPHLNO-070920-2
Name
MO2-xrcc6
Previous Names
None
Target
Sequence
5' - AACTTTTTAGGCTCACCTGCATAGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
A splice blocking morpholino at the end of the second exon.
Genome Resources
None
Target Location
View all 3 target locations
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-xrcc6
No data available
Phenotype
Phenotype resulting from MO2-xrcc6
No data available
Phenotype of all Fish created by or utilizing MO2-xrcc6
Citations