Morpholino
MO2-htt
- ID
- ZDB-MRPHLNO-070917-2
- Name
- MO2-htt
- Previous Names
-
- MO2-hd (1)
- Target
- Sequence
-
5' - GATATAATCTGATCGGAGATAGGGT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-htt
No data available
Phenotype
Phenotype resulting from MO2-htt
1 - 5 of 15 Show all
Phenotype of all Fish created by or utilizing MO2-htt
1 - 5 of 15 Show all
Citations
- Diekmann, H., Anichtchik, O., Fleming, A., Futter, M., Goldsmith, P., Roach, A., and Rubinsztein, D.C. (2009) Decreased BDNF levels are a major contributor to the embryonic phenotype of huntingtin knockdown zebrafish. The Journal of neuroscience : the official journal of the Society for Neuroscience. 29(5):1343-1349
- Henshall, T.L., Tucker, B., Lumsden, A.L., Nornes, S., Lardelli, M.T., and Richards, R.I. (2009) Selective neuronal requirement for Huntingtin in the developing zebrafish. Human molecular genetics. 18(24):4830-4842
- Lumsden, A.L., Henshall, T.L., Dayan, S., Lardelli, M.T., and Richards, R.I. (2007) Huntingtin-deficient zebrafish exhibit defects in iron utilization and development. Human molecular genetics. 16(16):1905-1920
1 - 3 of 3
Show